PDZ and LIM domain 3 (PDLIM3) - coding DNA reference sequence

(used for mutation description)

(last modified April 10, 2012)


This file was created to facilitate the description of sequence variants in the PDLIM3 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_032576.1, covering PDLIM3 transcript variant-1 (NM_014476.4). Transcript variant-2 lacks exons 5 and 6 but contains exon 4 instead (NM_014476.4), encoding PDLIM3-isoform b.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                                                    g.5004
                                                         cggt       c.-121

 .         .         .         .         .         .                g.5064
 gacgtcacccccagcggggataaagcgcccccgcccgggtcggggccaggacgccgcccg       c.-61

 .         .         .         .         .         .                g.5124
 gcgcggagtggctgccctgcgcggggacacttagagcccggtgggcgggaggaaggcggc       c.-1

          .         .         .         .         .         .       g.5184
 ATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGGCTTCAGGCTCTCAGGGGGC       c.60
 M  P  Q  T  V  I  L  P  G  P  A  P  W  G  F  R  L  S  G  G         p.20

          .         .         .    | 02    .         .         .    g.15414
 ATAGACTTCAACCAGCCTTTGGTCATCACCAGG | ATTACACCAGGAAGCAAGGCGGCAGCT    c.120
 I  D  F  N  Q  P  L  V  I  T  R   | I  T  P  G  S  K  A  A  A      p.40

          .         .         .         .         .         .       g.15474
 GCCAACCTGTGTCCTGGAGATGTCATCCTGGCTATTGACGGCTTTGGGACAGAGTCCATG       c.180
 A  N  L  C  P  G  D  V  I  L  A  I  D  G  F  G  T  E  S  M         p.60

          .         .         .         .         .         .       g.15534
 ACTCATGCTGATGCGCAGGACAGGATTAAAGCAGCAGCTCACCAGCTGTGTCTCAAAATT       c.240
 T  H  A  D  A  Q  D  R  I  K  A  A  A  H  Q  L  C  L  K  I         p.80

       | 03  .         .         .         .         .         .    g.17167
 GACAG | GGGAGAAACTCACTTATGGTCTCCACAAGTATCTGAAGATGGGAAAGCCCATCCT    c.300
 D  R  |  G  E  T  H  L  W  S  P  Q  V  S  E  D  G  K  A  H  P      p.100

          .         .         . | 05       .         .         .    g.26251
 TTCAAAATCAACTTAGAATCAGAACCACAG | GACGGGAACTACTTTGAACACAAGCATAAT    c.360
 F  K  I  N  L  E  S  E  P  Q   | D  G  N  Y  F  E  H  K  H  N      p.120
                                ^  alternatively spliced, replaced by exon 4

          .         .         .         | 06         .         .    g.32018
 ATTCGGCCCAAACCTTTCGTGATCCCGGGCCGAAGCAG | TGGATGCAGCACTCCCTCCGGG    c.420
 I  R  P  K  P  F  V  I  P  G  R  S  S  |  G  C  S  T  P  S  G      p.140

          .         .         .         .         .         .       g.32078
 ATTGACTGTGGCAGTGGACGCAGCACCCCTTCTTCTGTCAGTACTGTTAGTACCATTTGC       c.480
 I  D  C  G  S  G  R  S  T  P  S  S  V  S  T  V  S  T  I  C         p.160

          .         .         .         .         .         .       g.32138
 CCAGGTGACTTGAAAGTTGCGGCTAAGCTGGCCCCTAACATTCCTTTGGAAATGGAACTT       c.540
 P  G  D  L  K  V  A  A  K  L  A  P  N  I  P  L  E  M  E  L         p.180

          .         .         .         .         .         .       g.32198
 CCTGGTGTGAAGATTGTACATGCTCAGTTTAATACACCTATGCAGTTGTACTCAGATGAC       c.600
 P  G  V  K  I  V  H  A  Q  F  N  T  P  M  Q  L  Y  S  D  D         p.200

          .         .         .         .         .         .       g.32258
 AATATTATGGAAACACTCCAGGGTCAGGTTTCAACAGCCCTAGGGGAAACACCTTTGATG       c.660
 N  I  M  E  T  L  Q  G  Q  V  S  T  A  L  G  E  T  P  L  M         p.220

    | 07     .         .         .         .         .         .    g.33964
 AG | CGAGCCCACAGCCTCGGTGCCCCCCGAGTCGGACGTGTACCGGATGCTCCACGACAAT    c.720
 S  |  E  P  T  A  S  V  P  P  E  S  D  V  Y  R  M  L  H  D  N      p.240

          .         .         .         .         .         .       g.34024
 CGGAATGAGCCCACACAGCCTCGCCAGTCGGGCTCCTTCAGAGTGCTCCAGGGAATGGTG       c.780
 R  N  E  P  T  Q  P  R  Q  S  G  S  F  R  V  L  Q  G  M  V         p.260

          .    | 08    .         .         .         .         .    g.36019
 GACGATGGCTCTG | ATGACCGTCCGGCTGGAACGCGGAGTGTGAGAGCTCCGGTGACGAAA    c.840
 D  D  G  S  D |   D  R  P  A  G  T  R  S  V  R  A  P  V  T  K      p.280

          .         .         .         .         .         .       g.36079
 GTCCATGGCGGTTCAGGCGGGGCACAGAGGATGCCGCTCTGTGACAAATGTGGGAGTGGC       c.900
 V  H  G  G  S  G  G  A  Q  R  M  P  L  C  D  K  C  G  S  G         p.300

       | 09  .         .         .         .         .         .    g.38130
 ATAGT | CGGTGCTGTGGTGAAGGCGCGGGATAAGTACCGGCACCCTGAGTGCTTCGTGTGT    c.960
 I  V  |  G  A  V  V  K  A  R  D  K  Y  R  H  P  E  C  F  V  C      p.320

          .         .         .         .         .         .       g.38190
 GCCGACTGCAACCTCAACCTCAAGCAAAAGGGCTACTTCTTCATAGAAGGGGAGCTGTAC       c.1020
 A  D  C  N  L  N  L  K  Q  K  G  Y  F  F  I  E  G  E  L  Y         p.340

          .         .         .         .         .         .       g.38250
 TGCGAAACCCACGCAAGAGCCCGCACAAAGCCCCCAGAGGGCTATGACACGGTCACTCTG       c.1080
 C  E  T  H  A  R  A  R  T  K  P  P  E  G  Y  D  T  V  T  L         p.360

          .                                                         g.38265
 TATCCCAAAGCTTAA                                                    c.1095
 Y  P  K  A  X                                                      p.364

          .         .         .         .         .         .       g.38325
 gtctctgcaggcgtggcacgcacgcacgcacccacccacgcgcacttacacgagaagaca       c.*60

          .         .         .         .         .         .       g.38385
 ttcatggctttgggcagaaggattgtgcagattgtcaactccaaatctaaagtcaaggct       c.*120

          .         .         .         .         .         .       g.38445
 ttagacctttatcctattgtttattgaggaaaaggaatgggaggcaaatgcctgctatgt       c.*180

          .         .         .         .         .         .       g.38505
 gaaaaaaacatacacttagctatgttttgcaactctttttggggctagcaataatgatat       c.*240

          .         .         .         .         .         .       g.38565
 ttaaagcaataattttttgtatgtcatactccacaatttacatgtatattacagccatca       c.*300

          .         .         .         .         .         .       g.38625
 aacacataaacatcaagatatttgaaggactctaattgtctttccttgacaagttgattt       c.*360

          .         .         .         .         .         .       g.38685
 tgcaattgtggtaaatagcaaataacaatcttgtattctaacataatctgcagttgtctg       c.*420

          .         .         .         .         .         .       g.38745
 tatgtgttttaactattacagtgcatgttagggagaaattccctgaatttctttagtttt       c.*480

          .         .         .         .         .         .       g.38805
 gtattcaaacaattatgccactcgatgcaacaaacataataaatacataaaagatttaaa       c.*540

          .         .         .         .         .         .       g.38865
 aaatacctaatgaagtggcattcattgaattcaaataaaatcaacatttcaatgagagaa       c.*600

          .         .         .         .         .         .       g.38925
 cccaatcatattttaacatgtacactaacaaatattttaagataaatgtggcttcttcag       c.*660

          .         .         .         .         .         .       g.38985
 gttttataactcattactctttcttatgagcacaaaatttctgatgatagaagcgttgaa       c.*720

          .         .         .         .         .         .       g.39045
 atttgctagttaaaggtagttcagtctctttcaaattaaaagtttcacttgcttcaacag       c.*780

          .         .         .         .         .         .       g.39105
 agactctttcaatttaaatatctctttcagatcaatattcagtcaaattgaaggttcaaa       c.*840

          .         .         .         .         .         .       g.39165
 gtccatcactgctgtttcttaggctcaatggttcaccacctcctcctcttcccaagatgg       c.*900

          .         .         .         .         .         .       g.39225
 catctccaggaagaaacaatttagacgacttcctaaggaaggcaggggctgctggtctcc       c.*960

          .         .         .         .         .         .       g.39285
 tggggtcctgcttgtatccactgttgaaatccttggtttcacttgtgatctgtggtctgt       c.*1020

          .         .         .         .         .         .       g.39345
 tttcttgacatagttgaggccaggcaataataacacctccactaccacctccaaaactct       c.*1080

          .         .         .         .         .         .       g.39405
 cagctcagctttcctggagtcatggatcctctgtctgagacatgcactctgcctggccct       c.*1140

          .         .         .         .         .         .       g.39465
 ggcgcaggcagcctaccttgcaggctctgcatggcgttaccttgcctctcacccagggtg       c.*1200

          .         .         .         .         .         .       g.39525
 cccatggcaatgctcctgacttgcatctctcacctactttccatgtcccccactggggac       c.*1260

          .         .         .         .         .         .       g.39585
 gtacaggaacttctgaaactgtcccctcaggttcaaaccatggggaaccagcagggtggg       c.*1320

          .         .         .         .         .         .       g.39645
 gaccctcagaccctctgtctcaccaccttgtgtcacatggtcatctctaccacccctcaa       c.*1380

          .         .         .         .         .         .       g.39705
 cccccacagctgctaacttctggcctgaaacaagtgttctcctcccataaggtcccaaat       c.*1440

          .         .         .         .         .         .       g.39765
 gggacacaagttttattgctctgggattcttccaaacttaactgactctgaccctgacct       c.*1500

          .         .         .         .         .         .       g.39825
 gttcaggattttgagaggagccaaaacacgtgcctggcccctgtaggcatttgacattgc       c.*1560

          .         .         .         .         .         .       g.39885
 aactcctgtgccaacacatgcattcactaacaaagctattaaaaaaataaaacagacttt       c.*1620

          .                                                         g.39899
 tgagatcaaagaaa                                                     c.*1634

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The PDZ and LIM domain 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
2004-2012 Leiden University Medical Center