Nebulin (NEB) - coding DNA reference sequence

(used for mutation description)

(last modified October 19, 2013)


This file was created to facilitate the description of sequence variants in the NEB gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_009382.2, covering transcript variant-4 (NM_001271208.1), containing all 183 exons. In reality exons 143 and 144 have thus far not been found together in one transcript (see variant-1 (NM_001164507.1) and variant-2 (NM_001164508.1)). Transcript variant-3 misses exons 82-105 (NM_004543.4).
NOTE: the sequence contains three identical blocks (exons 82-89, 90-97 and 98-105); variants found here can not be mapped exactly. The three repeated blocks roughly go from position c.12330+176_13789-968 (81i_89i), c.13789-969_15247-968 (89i_97i) and c.15247-969_16705-1485 (97i_105i). Blocks can be discriminated using intronic variants.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                         .         .                g.5023
                                      aggcatcacgctggcttttgcct       c.-181

 .         .         .         .         .         .                g.5083
 ggggttctcaggaggggagagttgggagaggctttgctgctgaggaaatttatttggtag       c.-121

 .       | 02 .         .         .         .         .             g.5745
 attgaag | gtttgaacgagagctacagaaacgaaagaaaaagtctgtataagccaatggtg    c.-61

 .         .         .         . | 03       .         .             g.6331
 ttcgggaagaaaataaccccattgccttgag | tttgtaggtgccactactactctggaaaa    c.-1

          .         .         .       | 04 .         .         .    g.9855
 ATGGCAGATGACGAAGACTATGAGGAGGTGGTGGAG | TACTACACAGAAGAAGTGGTTTAC    c.60
 M  A  D  D  E  D  Y  E  E  V  V  E   | Y  Y  T  E  E  V  V  Y      p.20

          .         | 05         .         .         .         .    g.11623
 GAAGAGGTGCCGGGAGAG | ACAATAACAAAAATTTATGAGACTACGACAACAAGGACATCT    c.120
 E  E  V  P  G  E   | T  I  T  K  I  Y  E  T  T  T  T  R  T  S      p.40

          .         .         .         .         .         .       g.11683
 GACTATGAGCAATCAGAAACTTCCAAACCAGCTCTGGCACAGCCAGCACTGGCACAGCCA       c.180
 D  Y  E  Q  S  E  T  S  K  P  A  L  A  Q  P  A  L  A  Q  P         p.60

          .         .         .         .         .         .       g.11743
 GCATCAGCAAAGCCGGTGGAGAGGAGGAAGGTCATCCGGAAGAAAGTGGATCCTTCAAAG       c.240
 A  S  A  K  P  V  E  R  R  K  V  I  R  K  K  V  D  P  S  K         p.80

          .         .         .         .         .     | 06   .    g.13933
 TTCATGACCCCCTACATTGCACACAGTCAGAAAATGCAGGATCTTTTTAGCCCA | AATAAA    c.300
 F  M  T  P  Y  I  A  H  S  Q  K  M  Q  D  L  F  S  P   | N  K      p.100

          .         .         .         .         .         .       g.13993
 TACAAGGAGAAGTTTGAGAAAACAAAAGGACAGCCATACGCCAGCACAACAGATACTCCA       c.360
 Y  K  E  K  F  E  K  T  K  G  Q  P  Y  A  S  T  T  D  T  P         p.120

          .         .         .         .   | 07     .         .    g.14544
 GAACTTCGCAGAATCAAAAAAGTACAAGATCAACTCAGTGAG | GTTAAGTATCGAATGGAT    c.420
 E  L  R  R  I  K  K  V  Q  D  Q  L  S  E   | V  K  Y  R  M  D      p.140

          .         .         .         .         .         .       g.14604
 GGTGATGTTGCTAAGACTATATGTCACGTAGATGAAAAAGCAAAGGATATTGAACATGCA       c.480
 G  D  V  A  K  T  I  C  H  V  D  E  K  A  K  D  I  E  H  A         p.160

          .         .        | 08.         .         .         .    g.15156
 AAGAAAGTGTCGCAGCAAGTCAGTAAG | GTTTTATACAAGCAGAACTGGGAAGACACCAAG    c.540
 K  K  V  S  Q  Q  V  S  K   | V  L  Y  K  Q  N  W  E  D  T  K      p.180

          .         .         .         .         .         .       g.15216
 GATAAGTACCTGCTTCCTCCTGATGCCCCTGAACTTGTCCAGGCCGTTAAGAACACCGCC       c.600
 D  K  Y  L  L  P  P  D  A  P  E  L  V  Q  A  V  K  N  T  A         p.200

          .   | 09     .         .         .         .         .    g.16049
 ATGTTCAGCAAG | AAACTGTACACTGAAGACTGGGAAGCAGACAAAAGTTTGTTTTACCCC    c.660
 M  F  S  K   | K  L  Y  T  E  D  W  E  A  D  K  S  L  F  Y  P      p.220

          .         .         .         .         .        | 10.    g.21970
 TATAATGATAGCCCGGAACTGAGGAGAGTTGCCCAGGCCCAGAAAGCTCTCAGTGAT | GTT    c.720
 Y  N  D  S  P  E  L  R  R  V  A  Q  A  Q  K  A  L  S  D   | V      p.240

          .         .         .         .         .         .       g.22030
 GCCTACAAAAAAGGTCTCGCTGAACAGCAAGCTCAATTCACGCCTCTGGCTGATCCTCCA       c.780
 A  Y  K  K  G  L  A  E  Q  Q  A  Q  F  T  P  L  A  D  P  P         p.260

          .         .         .         .   | 11     .         .    g.28967
 GATATAGAATTTGCCAAGAAAGTAACCAATCAAGTGAGCAAG | CAAAAATACAAAGAAGAC    c.840
 D  I  E  F  A  K  K  V  T  N  Q  V  S  K   | Q  K  Y  K  E  D      p.280

          .         .         .         .         .         .       g.29027
 TATGAAAATAAAATCAAAGGCAAATGGAGTGAGACACCTTGCTTTGAAGTTGCAAATGCC       c.900
 Y  E  N  K  I  K  G  K  W  S  E  T  P  C  F  E  V  A  N  A         p.300

          .         .        | 12.         .         .         .    g.29757
 AGAATGAATGCTGATAACATTAGCACA | AGGAAATACCAGGAAGATTTTGAAAACATGAAA    c.960
 R  M  N  A  D  N  I  S  T   | R  K  Y  Q  E  D  F  E  N  M  K      p.320

          .         .         .         .         .         .       g.29817
 GACCAGATCTACTTCATGCAGACCGAAACACCAGAGTATAAAATGAATAAAAAAGCTGGT       c.1020
 D  Q  I  Y  F  M  Q  T  E  T  P  E  Y  K  M  N  K  K  A  G         p.340

          .      | 13  .         .         .         .         .    g.32535
 GTGGCAGCTAGCAAG | GTAAAATACAAAGAAGACTATGAAAAGAATAAAGGAAAAGCAGAT    c.1080
 V  A  A  S  K   | V  K  Y  K  E  D  Y  E  K  N  K  G  K  A  D      p.360

          .         .         .         .         .         .       g.32595
 TATAATGTGCTTCCTGCTTCAGAGAACCCACAGCTTAGGCAGCTGAAGGCAGCAGGAGAT       c.1140
 Y  N  V  L  P  A  S  E  N  P  Q  L  R  Q  L  K  A  A  G  D         p.380

          .   | 14     .         .         .         .         .    g.41887
 GCCCTAAGTGAC | AAACTATACAAGGAAAACTATGAAAAGACAAAAGCAAAGAGCATAAAT    c.1200
 A  L  S  D   | K  L  Y  K  E  N  Y  E  K  T  K  A  K  S  I  N      p.400

          .         .         .         .         .        | 15.    g.42033
 TACTGCGAGACCCCCAAATTCAAGCTCGATACTGTTCTGCAGAACTTCAGTAGTGAT | AAA    c.1260
 Y  C  E  T  P  K  F  K  L  D  T  V  L  Q  N  F  S  S  D   | K      p.420

          .         .         .         .         .         .       g.42093
 AAATATAAAGATTCCTACTTAAAAGATATTTTGGGACATTATGTAGGCAGCTTCGAGGAT       c.1320
 K  Y  K  D  S  Y  L  K  D  I  L  G  H  Y  V  G  S  F  E  D         p.440

          .         .         .         .      | 16  .         .    g.42250
 CCATACCATTCACACTGCATGAAAGTCACAGCTCAAAACAGTGAT | AAAAACTACAAAGCA    c.1380
 P  Y  H  S  H  C  M  K  V  T  A  Q  N  S  D   | K  N  Y  K  A      p.460

          .         .         .         .         .         .       g.42310
 GAATACGAAGAAGACAGAGGCAAAGGCTTCTTCCCTCAGACCATAACTCAAGAATATGAA       c.1440
 E  Y  E  E  D  R  G  K  G  F  F  P  Q  T  I  T  Q  E  Y  E         p.480

          .         .         . | 17       .         .         .    g.42782
 GCAATTAAGAAACTAGATCAGTGTAAAGAC | CACACCTACAAAGTCCATCCAGATAAGACA    c.1500
 A  I  K  K  L  D  Q  C  K  D   | H  T  Y  K  V  H  P  D  K  T      p.500

          .         .         .         .         .         .       g.42842
 AAATTCACCCAAGTTACAGACTCTCCTGTTCTGCTACAAGCCCAAGTCAATTCCAAACAA       c.1560
 K  F  T  Q  V  T  D  S  P  V  L  L  Q  A  Q  V  N  S  K  Q         p.520

           | 18        .         .         .         .         .    g.43856
 CTGAGTGAC | TTAAATTACAAAGCAAAACATGAAAGTGAAAAGTTCAAGTGCCATATCCCC    c.1620
 L  S  D   | L  N  Y  K  A  K  H  E  S  E  K  F  K  C  H  I  P      p.540

          .         .         .         .         .     | 19   .    g.44864
 CCTGATACTCCTGCTTTTATCCAGCACAAAGTCAATGCCTATAACTTGAGTGAT | AATCTT    c.1680
 P  D  T  P  A  F  I  Q  H  K  V  N  A  Y  N  L  S  D   | N  L      p.560

          .         .         .         .         .         .       g.44924
 TATAAGCAAGACTGGGAGAAGAGCAAAGCCAAAAAGTTTGACATTAAAGTGGATGCCATT       c.1740
 Y  K  Q  D  W  E  K  S  K  A  K  K  F  D  I  K  V  D  A  I         p.580

          .         .         .         .   | 20     .         .    g.45069
 CCCCTGCTGGCAGCCAAAGCCAACACCAAGAACACCAGCGAT | GTGATGTACAAGAAAGAC    c.1800
 P  L  L  A  A  K  A  N  T  K  N  T  S  D   | V  M  Y  K  K  D      p.600

          .         .         .         .         .         .       g.45129
 TATGAAAAAAACAAAGGGAAAATGATTGGAGTCCTCAGCATTAATGACGATCCCAAGATG       c.1860
 Y  E  K  N  K  G  K  M  I  G  V  L  S  I  N  D  D  P  K  M         p.620

          .         .         .       | 21 .         .         .    g.47149
 CTGCACTCCTTGAAGGTGGCCAAAAACCAGAGTGAT | AGATTATACAAGGAAAACTATGAG    c.1920
 L  H  S  L  K  V  A  K  N  Q  S  D   | R  L  Y  K  E  N  Y  E      p.640

          .         .         .         .         .         .       g.47209
 AAGACAAAGGCAAAGAGTATGAATTACTGTGAGACCCCAAAATATCAACTTGATACTCAG       c.1980
 K  T  K  A  K  S  M  N  Y  C  E  T  P  K  Y  Q  L  D  T  Q         p.660

          .         | 22         .         .         .         .    g.47363
 CTGAAGAACTTCAGTGAG | GCTAGATATAAAGACTTATATGTAAAGGATGTTTTGGGACAT    c.2040
 L  K  N  F  S  E   | A  R  Y  K  D  L  Y  V  K  D  V  L  G  H      p.680

          .         .         .         .         .         .       g.47423
 TATGTAGGCAGCATGGAGGACCCATATCACACACACTGCATGAAAGTTGCAGCTCAAAAC       c.2100
 Y  V  G  S  M  E  D  P  Y  H  T  H  C  M  K  V  A  A  Q  N         p.700

        | 23 .         .         .         .         .         .    g.47573
 AGTGAT | AAAAGTTACAAAGCAGAATATGAAGAAGATAAAGGAAAATGCTATTTCCCTCAG    c.2160
 S  D   | K  S  Y  K  A  E  Y  E  E  D  K  G  K  C  Y  F  P  Q      p.720

          .         .         .         .         .  | 24      .    g.48671
 ACAATAACACAAGAATATGAAGCAATCAAGAAGCTGGACCAGTGTAAAGAT | CATACCTAC    c.2220
 T  I  T  Q  E  Y  E  A  I  K  K  L  D  Q  C  K  D   | H  T  Y      p.740

          .         .         .         .         .         .       g.48731
 AAAGTTCATCCAGATAAGACCAAATTCACGGCAGTCACTGATTCTCCTGTACTGTTGCAA       c.2280
 K  V  H  P  D  K  T  K  F  T  A  V  T  D  S  P  V  L  L  Q         p.760

          .         .         . | 25       .         .         .    g.51121
 GCCCAGCTCAACACGAAACAGCTTAGTGAT | CTGAATTACAAAGCAAAACATGAAGGTGAG    c.2340
 A  Q  L  N  T  K  Q  L  S  D   | L  N  Y  K  A  K  H  E  G  E      p.780

          .         .         .         .         .         .       g.51181
 AAGTTCAAGTGCCATATACCAGCAGATGCTCCACAGTTTATCCAACACAGAGTCAATGCC       c.2400
 K  F  K  C  H  I  P  A  D  A  P  Q  F  I  Q  H  R  V  N  A         p.800

          .      | 26  .         .         .         .         .    g.51799
 TATAATCTGAGTGAT | AATGTTTATAAGCAAGACTGGGAGAAGAGCAAAGCCAAGAAGTTT    c.2460
 Y  N  L  S  D   | N  V  Y  K  Q  D  W  E  K  S  K  A  K  K  F      p.820

          .         .         .         .         .         .       g.51859
 GACATTAAAGTGGACGCCATTCCCCTGTTGGCAGCCAAAGCCAACACCAAGAACACCAGC       c.2520
 D  I  K  V  D  A  I  P  L  L  A  A  K  A  N  T  K  N  T  S         p.840

     | 27    .         .         .         .         .         .    g.52012
 GAT | GTGATGTACAAGAAAGACTATGAAAAGAGCAAAGGGAAAATGATTGGAGCCCTCAGC    c.2580
 D   | V  M  Y  K  K  D  Y  E  K  S  K  G  K  M  I  G  A  L  S      p.860

          .         .         .         .         .        | 28.    g.54515
 ATTAATGACGATCCAAAGATGCTGCACTCCTTGAAGACAGCCAAAAACCAGAGTGAT | CGC    c.2640
 I  N  D  D  P  K  M  L  H  S  L  K  T  A  K  N  Q  S  D   | R      p.880

          .         .         .         .         .         .       g.54575
 GAATATCGAAAAGATTATGAAAAGTCAAAAACTATCTACACGGCACCTCTTGATATGCTC       c.2700
 E  Y  R  K  D  Y  E  K  S  K  T  I  Y  T  A  P  L  D  M  L         p.900

          .         .         .         .         .         .       g.54635
 CAAGTCACTCAAGCTAAGAAATCTCAGGCAATTGCCAGCGACGTTGATTATAAGCACATC       c.2760
 Q  V  T  Q  A  K  K  S  Q  A  I  A  S  D  V  D  Y  K  H  I         p.920

          .         .         .         .         .         .       g.54695
 TTACACAGTTACAGCTACCCCCCTGATAGCATCAATGTGGACCTTGCCAAGAAGGCATAT       c.2820
 L  H  S  Y  S  Y  P  P  D  S  I  N  V  D  L  A  K  K  A  Y         p.940

          .      | 29  .         .         .         .         .    g.56763
 GCGCTGCAGAGCGAT | GTTGAATACAAAGCTGACTACAATAGCTGGATGAAAGGTTGTGGC    c.2880
 A  L  Q  S  D   | V  E  Y  K  A  D  Y  N  S  W  M  K  G  C  G      p.960

          .         .         .         .         .         .       g.56823
 TGGGTGCCTTTTGGGTCCTTAGAAATGGAAAAGGCAAAGCGAGCTTCAGACATCCTCAAT       c.2940
 W  V  P  F  G  S  L  E  M  E  K  A  K  R  A  S  D  I  L  N         p.980

     | 30    .         .         .         .         .         .    g.58716
 GAG | AAAAAATATCGCCAACATCCAGACACCCTCAAGTTTACCTCGATTGAAGATGCTCCA    c.3000
 E   | K  K  Y  R  Q  H  P  D  T  L  K  F  T  S  I  E  D  A  P      p.1000

          .         .         .         .   | 31     .         .    g.59483
 ATTACAGTACAGTCTAAAATTAACCAGGCCCAGAGGAGTGAT | ATCGCTTACAAAGCCAAA    c.3060
 I  T  V  Q  S  K  I  N  Q  A  Q  R  S  D   | I  A  Y  K  A  K      p.1020

          .         .         .         .         .         .       g.59543
 GGAGAGGAAATTATTCACAAATACAACCTGCCACCAGACCTGCCCCAGTTCATCCAGGCT       c.3120
 G  E  E  I  I  H  K  Y  N  L  P  P  D  L  P  Q  F  I  Q  A         p.1040

          .         .        | 32.         .         .         .    g.59692
 AAAGTTAATGCCTACAATATCAGTGAG | AATATGTACAAAGCAGACTTGAAAGACTTGAGC    c.3180
 K  V  N  A  Y  N  I  S  E   | N  M  Y  K  A  D  L  K  D  L  S      p.1060

          .         .         .         .         .         .       g.59752
 AAGAAGGGATATGACCTGAGAACTGATGCGATTCCCATCAGAGCTGCCAAAGCTGCCAGG       c.3240
 K  K  G  Y  D  L  R  T  D  A  I  P  I  R  A  A  K  A  A  R         p.1080

          .      | 33  .         .         .         .         .    g.61345
 CAGGCGGCGAGTGAC | GTTCAGTACAAAAAAGACTATGAAAAGGCTAAAGGGAAAATGGTT    c.3300
 Q  A  A  S  D   | V  Q  Y  K  K  D  Y  E  K  A  K  G  K  M  V      p.1100

          .         .         .         .         .         .       g.61405
 GGCTTCCAAAGTCTTCAAGATGACCCTAAACTGGTTCATTATATGAACGTGGCCAAGATA       c.3360
 G  F  Q  S  L  Q  D  D  P  K  L  V  H  Y  M  N  V  A  K  I         p.1120

          .         .         .         .         .         .       g.61465
 CAATCAGATCGGGAGTATAAAAAAGACTATGAGAAGACAAAGTCCAAATACAACACGCCC       c.3420
 Q  S  D  R  E  Y  K  K  D  Y  E  K  T  K  S  K  Y  N  T  P         p.1140

          .         .         .         .         .         .       g.61525
 CATGATATGTTCAATGTCGTGGCGGCTAAGAAAGCCCAGGATGTGGTCAGCAATGTCAAC       c.3480
 H  D  M  F  N  V  V  A  A  K  K  A  Q  D  V  V  S  N  V  N         p.1160

          .         .         .         .         .         .       g.61585
 TATAAGCATTCTCTCCATCATTACACCTACTTGCCTGACGCCATGGACCTGGAGCTGTCT       c.3540
 Y  K  H  S  L  H  H  Y  T  Y  L  P  D  A  M  D  L  E  L  S         p.1180

          .         .        | 34.         .         .         .    g.61749
 AAGAACATGATGCAGATACAGAGTGAT | AACGTCTACAAGGAAGACTACAACAACTGGATG    c.3600
 K  N  M  M  Q  I  Q  S  D   | N  V  Y  K  E  D  Y  N  N  W  M      p.1200

          .         .         .         .         .         .       g.61809
 AAAGGCATTGGCTGGATTCCTATTGGCAGTCTCGACGTCGAAAAAGTTAAAAAGGCCGGT       c.3660
 K  G  I  G  W  I  P  I  G  S  L  D  V  E  K  V  K  K  A  G         p.1220

          .         .         .         .         .         .       g.61869
 GATGCTCTGAATGAAAAGAAGTACAGGCAACATCCAGACACCCTCAAATTTACCAGCATT       c.3720
 D  A  L  N  E  K  K  Y  R  Q  H  P  D  T  L  K  F  T  S  I         p.1240

          .         .         .         .         .     | 35   .    g.64102
 GTGGACTCCCCAGTTATGGTCCAGGCAAAACAGAACACGAAGCAAGTCAGTGAT | ATCTTA    c.3780
 V  D  S  P  V  M  V  Q  A  K  Q  N  T  K  Q  V  S  D   | I  L      p.1260

          .         .         .         .         .         .       g.64162
 TACAAGGCTAAAGGAGAAGATGTGAAACATAAATACACCATGAGTCCTGATCTTCCTCAG       c.3840
 Y  K  A  K  G  E  D  V  K  H  K  Y  T  M  S  P  D  L  P  Q         p.1280

          .         .         .          | 36        .         .    g.64924
 TTTCTCCAGGCCAAGTGCAATGCTTACAATATAAGTGAC | GTCTGTTATAAACGGGATTGG    c.3900
 F  L  Q  A  K  C  N  A  Y  N  I  S  D   | V  C  Y  K  R  D  W      p.1300

          .         .         .         .         .         .       g.64984
 CATGACTTAATAGCCAAGGGCAACAATGTGCTGGGCGATGCTATTCCCATCACTGCAGCC       c.3960
 H  D  L  I  A  K  G  N  N  V  L  G  D  A  I  P  I  T  A  A         p.1320

          .         .        | 37.         .         .         .    g.66840
 AAGGCATCGAGAAACATTGCCAGTGAT | TATAAATACAAGGAAGCTTATGAGAAGTCAAAG    c.4020
 K  A  S  R  N  I  A  S  D   | Y  K  Y  K  E  A  Y  E  K  S  K      p.1340

          .         .         .         .         .         .       g.66900
 GGAAAGCATGTGGGTTTCAGAAGCCTCCAGGATGATCCCAAGCTGGTCCACTATATGAAT       c.4080
 G  K  H  V  G  F  R  S  L  Q  D  D  P  K  L  V  H  Y  M  N         p.1360

          .         .         .         .         .         .       g.66960
 GTGGCAAAGCTGCAGTCTGATCGTGAATACAAGAAGAACTATGAGAACACCAAAACCAGC       c.4140
 V  A  K  L  Q  S  D  R  E  Y  K  K  N  Y  E  N  T  K  T  S         p.1380

          .         .         .         .         .         .       g.67020
 TACCATACCCCTGGGGACATGGTTAGCATCACAGCTGCAAAGATGGCCCAGGATGTCGCT       c.4200
 Y  H  T  P  G  D  M  V  S  I  T  A  A  K  M  A  Q  D  V  A         p.1400

          .         .         .         .         .         .       g.67080
 ACCAATGTCAACTACAAACAGCCATTGCATCATTACACATACCTACCTGACGCCATGAGT       c.4260
 T  N  V  N  Y  K  Q  P  L  H  H  Y  T  Y  L  P  D  A  M  S         p.1420

          .         .         .          | 38        .         .    g.68279
 CTTGAGCATACGAGGAATGTCAATCAAATTCAGAGTGAT | AATGTGTATAAAGACGAGTAT    c.4320
 L  E  H  T  R  N  V  N  Q  I  Q  S  D   | N  V  Y  K  D  E  Y      p.1440

          .         .         .         .         .         .       g.68339
 AACAGCTTCTTGAAGGGCATCGGATGGATCCCTATTGGTTCCCTGGAGGTGGAGAAGGTC       c.4380
 N  S  F  L  K  G  I  G  W  I  P  I  G  S  L  E  V  E  K  V         p.1460

          .         .         .         .         .         .       g.68399
 AAGAAAGCAGGCGATGCATTAAATGAGAGGAAGTATCGACAGCACCCAGATACCGTCAAG       c.4440
 K  K  A  G  D  A  L  N  E  R  K  Y  R  Q  H  P  D  T  V  K         p.1480

          .         .         .         .         .         .       g.68459
 TTCACAAGTGTGCCTGATTCCATGGGCATGGTGTTGGCTCAGCATAACACAAAGCAGCTA       c.4500
 F  T  S  V  P  D  S  M  G  M  V  L  A  Q  H  N  T  K  Q  L         p.1500

        | 39 .         .         .         .         .         .    g.70410
 AGTGAT | TTGAACTACAAGGTAGAGGGAGAGAAACTGAAGCACAAGTATACTATTGACCCT    c.4560
 S  D   | L  N  Y  K  V  E  G  E  K  L  K  H  K  Y  T  I  D  P      p.1520

          .         .         .         .         .  | 40      .    g.71585
 GAATTGCCTCAGTTTATTCAAGCCAAAGTCAACGCCCTCAACATGAGTGAT | GCTCATTAT    c.4620
 E  L  P  Q  F  I  Q  A  K  V  N  A  L  N  M  S  D   | A  H  Y      p.1540

          .         .         .         .         .         .       g.71645
 AAAGCAGATTGGAAGAAAACCATTGCCAAGGGCTATGATTTGAGACCAGATGCCATCCCA       c.4680
 K  A  D  W  K  K  T  I  A  K  G  Y  D  L  R  P  D  A  I  P         p.1560

          .         .         .          | 41        .         .    g.73107
 ATTGTTGCTGCAAAAAGTTCAAGGAATATTGCTAGTGAT | TGCAAATATAAGGAGGCCTAC    c.4740
 I  V  A  A  K  S  S  R  N  I  A  S  D   | C  K  Y  K  E  A  Y      p.1580

          .         .         .         .         .         .       g.73167
 GAGAAAGCCAAAGGCAAGCAAGTTGGATTTCTCAGTCTTCAGGATGATCCTAAACTGGTT       c.4800
 E  K  A  K  G  K  Q  V  G  F  L  S  L  Q  D  D  P  K  L  V         p.1600

          .         .         .         .         .         .       g.73227
 CACTACATGAATGTGGCCAAAATCCAGTCTGATCGTGAGTACAAAAAGGGCTATGAAGCC       c.4860
 H  Y  M  N  V  A  K  I  Q  S  D  R  E  Y  K  K  G  Y  E  A         p.1620

          .         .         .         .         .         .       g.73287
 AGCAAGACCAAGTACCACACACCTCTGGATATGGTCAGTGTGACAGCTGCAAAGAAATCT       c.4920
 S  K  T  K  Y  H  T  P  L  D  M  V  S  V  T  A  A  K  K  S         p.1640

          .         .         .         .         .         .       g.73347
 CAGGAGGTTGCCACCAACGCCAACTACAGACAGTCATACCACCACTACACTCTCCTGCCC       c.4980
 Q  E  V  A  T  N  A  N  Y  R  Q  S  Y  H  H  Y  T  L  L  P         p.1660

          .         .         .         .         .  | 42      .    g.73957
 GATGCCTTGAATGTGGAGCACTCCAGGAATGCCATGCAGATTCAGAGTGAT | AATCTGTAC    c.5040
 D  A  L  N  V  E  H  S  R  N  A  M  Q  I  Q  S  D   | N  L  Y      p.1680

          .         .         .         .         .         .       g.74017
 AAATCTGACTTCACCAATTGGATGAAAGGGATCGGCTGGGTGCCCATAGAGTCCCTGGAG       c.5100
 K  S  D  F  T  N  W  M  K  G  I  G  W  V  P  I  E  S  L  E         p.1700

          .         .         .         .         .         .       g.74077
 GTGGAGAAGGCAAAGAAAGCAGGAGAGATTCTTAGTGAGAAGAAGTATCGCCAGCACCCC       c.5160
 V  E  K  A  K  K  A  G  E  I  L  S  E  K  K  Y  R  Q  H  P         p.1720

          .         .         .         .         .         .       g.74137
 GAGAAGCTGAAGTTCACTTACGCCATGGACACAATGGAACAGGCACTTAACAAGAGTAAC       c.5220
 E  K  L  K  F  T  Y  A  M  D  T  M  E  Q  A  L  N  K  S  N         p.1740

          .         | 43         .         .         .         .    g.74666
 AAACTGAACATGGACAAG | AGGCTCTACACTGAAAAATGGAACAAGGACAAGACCACCATT    c.5280
 K  L  N  M  D  K   | R  L  Y  T  E  K  W  N  K  D  K  T  T  I      p.1760

          .         .         .         .         .         .       g.74726
 CATGTCATGCCTGACACACCGGATATTTTACTCTCCAGAGTAAACCAAATCACCATGAGT       c.5340
 H  V  M  P  D  T  P  D  I  L  L  S  R  V  N  Q  I  T  M  S         p.1780

     | 44    .         .         .         .         .         .    g.74936
 GAT | AAACTGTACAAAGCTGGCTGGGAAGAGGAAAAGAAGAAAGGATATGACCTGAGGCCT    c.5400
 D   | K  L  Y  K  A  G  W  E  E  E  K  K  K  G  Y  D  L  R  P      p.1800

          .         .         .         .         .  | 45      .    g.75637
 GATGCCATTGCAATAAAGGCTGCAAGAGCCTCTAGAGACATTGCCAGTGAT | TACAAATAC    c.5460
 D  A  I  A  I  K  A  A  R  A  S  R  D  I  A  S  D   | Y  K  Y      p.1820

          .         .         .         .         .         .       g.75697
 AAGAAAGCCTATGAACAAGCCAAAGGGAAACACATTGGCTTCCGGAGCCTGGAAGATGAC       c.5520
 K  K  A  Y  E  Q  A  K  G  K  H  I  G  F  R  S  L  E  D  D         p.1840

          .         .         .         .         .         .       g.75757
 CCCAAGCTGGTGCACTTCATGCAAGTGGCCAAGATGCAGTCAGACCGGGAATACAAGAAG       c.5580
 P  K  L  V  H  F  M  Q  V  A  K  M  Q  S  D  R  E  Y  K  K         p.1860

          .         .         .         .         .         .       g.75817
 GGATATGAGAAATCCAAGACCTCCTTCCACACCCCGGTGGACATGCTCAGTGTGGTGGCA       c.5640
 G  Y  E  K  S  K  T  S  F  H  T  P  V  D  M  L  S  V  V  A         p.1880

          .         .         .         .         .         .       g.75877
 GCCAAGAAGTCTCAGGAAGTGGCCACCAATGCCAACTACAGGAACGTGATCCATACCTAC       c.5700
 A  K  K  S  Q  E  V  A  T  N  A  N  Y  R  N  V  I  H  T  Y         p.1900

          .         .         .         .         .         .       g.75937
 AACATGCTTCCTGATGCCATGAGCTTTGAATTGGCCAAAAATATGATGCAGATTCAAAGT       c.5760
 N  M  L  P  D  A  M  S  F  E  L  A  K  N  M  M  Q  I  Q  S         p.1920

     | 46    .         .         .         .         .         .    g.77203
 GAT | AATCAGTACAAGGCTGACTATGCTGACTTCATGAAGGGCATTGGATGGCTCCCTCTG    c.5820
 D   | N  Q  Y  K  A  D  Y  A  D  F  M  K  G  I  G  W  L  P  L      p.1940

          .         .         .         .         .         .       g.77263
 GGCTCCCTGGAAGCAGAGAAAAACAAGAAAGCCATGGAGATTATTAGTGAAAAGAAGTAC       c.5880
 G  S  L  E  A  E  K  N  K  K  A  M  E  I  I  S  E  K  K  Y         p.1960

          .         .         .         .         .         .       g.77323
 CGCCAGCACCCAGACACTTTGAAGTATTCCACACTCATGGACTCGATGAACATGGTTTTG       c.5940
 R  Q  H  P  D  T  L  K  Y  S  T  L  M  D  S  M  N  M  V  L         p.1980

          .         .         . | 47       .         .         .    g.80348
 GCCCAGAATAATGCAAAAATTATGAACGAA | CATCTCTACAAACAAGCATGGGAGGCTGAC    c.6000
 A  Q  N  N  A  K  I  M  N  E   | H  L  Y  K  Q  A  W  E  A  D      p.2000

          .         .         .         .         .         .       g.80408
 AAAACCAAAGTCCACATCATGCCTGATATCCCCCAGATTATTTTGGCAAAGGCAAATGCA       c.6060
 K  T  K  V  H  I  M  P  D  I  P  Q  I  I  L  A  K  A  N  A         p.2020

          .      | 48  .         .         .         .         .    g.81442
 ATTAATATGAGTGAT | AAACTCTACAAACTTTCCTTGGAAGAGTCTAAAAAGAAAGGCTAT    c.6120
 I  N  M  S  D   | K  L  Y  K  L  S  L  E  E  S  K  K  K  G  Y      p.2040

          .         .         .         .         .         .       g.81502
 GATCTCAGACCTGATGCAATTCCTATCAAAGCTGCCAAGGCTTCCAGAGATATTGCAAGT       c.6180
 D  L  R  P  D  A  I  P  I  K  A  A  K  A  S  R  D  I  A  S         p.2060

     | 49    .         .         .         .         .         .    g.83080
 GAT | TATAAATACAAGTACAATTATGAAAAAGGGAAGGGGAAAATGGTTGGTTTCCGCAGT    c.6240
 D   | Y  K  Y  K  Y  N  Y  E  K  G  K  G  K  M  V  G  F  R  S      p.2080

          .         .         .         .         .         .       g.83140
 CTCGAGGATGATCCCAAATTAGTCCATTCCATGCAAGTGGCTAAGATGCAATCTGATCGG       c.6300
 L  E  D  D  P  K  L  V  H  S  M  Q  V  A  K  M  Q  S  D  R         p.2100

          .         .         .         .         .         .       g.83200
 GAGTACAAGAAAAACTATGAGAACACAAAGACCAGCTACCACACCCCTGCCGACATGCTC       c.6360
 E  Y  K  K  N  Y  E  N  T  K  T  S  Y  H  T  P  A  D  M  L         p.2120

          .         .         .         .         .         .       g.83260
 AGTGTCACGGCTGCAAAGGATGCCCAAGCCAACATCACCAACACTAACTACAAGCACCTG       c.6420
 S  V  T  A  A  K  D  A  Q  A  N  I  T  N  T  N  Y  K  H  L         p.2140

          .         .         .         .         .         .       g.83320
 ATTCACAAGTACATCCTCCTTCCAGATGCAATGAACATTGAGCTGACCAGGAATATGAAT       c.6480
 I  H  K  Y  I  L  L  P  D  A  M  N  I  E  L  T  R  N  M  N         p.2160

          .      | 50  .         .         .         .         .    g.83509
 CGCATACAGAGTGAT | AATGAATATAAGCAAGATTACAATGAATGGTACAAAGGGCTTGGC    c.6540
 R  I  Q  S  D   | N  E  Y  K  Q  D  Y  N  E  W  Y  K  G  L  G      p.2180

          .         .         .         .         .         .       g.83569
 TGGAGTCCAGCAGGTTCTCTGGAAGTGGAGAAGGCCAAGAAAGCAACTGAATATGCCAGT       c.6600
 W  S  P  A  G  S  L  E  V  E  K  A  K  K  A  T  E  Y  A  S         p.2200

          .         .         .         .         .         .       g.83629
 GATCAGAAATACCGCCAGCACCCGAGCAACTTCCAGTTTAAGAAGCTGACTGATTCCATG       c.6660
 D  Q  K  Y  R  Q  H  P  S  N  F  Q  F  K  K  L  T  D  S  M         p.2220

          .         .         .         .   | 51     .         .    g.84131
 GACATGGTGCTTGCCAAGCAGAATGCACATACCATGAACAAG | CATTTATACACCATTGAT    c.6720
 D  M  V  L  A  K  Q  N  A  H  T  M  N  K   | H  L  Y  T  I  D      p.2240

          .         .         .         .         .         .       g.84191
 TGGAATAAAGATAAGACCAAGATTCATGTGATGCCTGATACACCAGATATTTTACAAGCC       c.6780
 W  N  K  D  K  T  K  I  H  V  M  P  D  T  P  D  I  L  Q  A         p.2260

          .         .        | 52.         .         .         .    g.85421
 AAGCAGAATCAAACACTGTATAGTCAG | AAACTCTATAAACTTGGATGGGAAGAAGCTTTG    c.6840
 K  Q  N  Q  T  L  Y  S  Q   | K  L  Y  K  L  G  W  E  E  A  L      p.2280

          .         .         .         .         .         .       g.85481
 AAGAAAGGCTATGATCTCCCAGTTGATGCAATTTCTGTACAGCTAGCTAAAGCTTCAAGA       c.6900
 K  K  G  Y  D  L  P  V  D  A  I  S  V  Q  L  A  K  A  S  R         p.2300

          .      | 53  .         .         .         .         .    g.88647
 GACATTGCTAGTGAT | TATAAATACAAACAAGGCTACCGAAAGCAACTTGGCCACCATGTT    c.6960
 D  I  A  S  D   | Y  K  Y  K  Q  G  Y  R  K  Q  L  G  H  H  V      p.2320

          .         .         .         .         .         .       g.88707
 GGATTCCGGAGTCTGCAAGATGACCCAAAACTTGTGTTGTCCATGAATGTAGCCAAAATG       c.7020
 G  F  R  S  L  Q  D  D  P  K  L  V  L  S  M  N  V  A  K  M         p.2340

          .         .         .         .         .         .       g.88767
 CAGAGTGAAAGAGAATACAAGAAGGACTTTGAGAAGTGGAAAACTAAGTTCTCCAGCCCA       c.7080
 Q  S  E  R  E  Y  K  K  D  F  E  K  W  K  T  K  F  S  S  P         p.2360

          .         .         .         .         .         .       g.88827
 GTGGACATGTTGGGAGTGGTACTGGCCAAGAAGTGTCAGGAGTTGGTTAGTGACGTGGAC       c.7140
 V  D  M  L  G  V  V  L  A  K  K  C  Q  E  L  V  S  D  V  D         p.2380

          .         .         .         .         .         .       g.88887
 TACAAGAACTACCTGCATCAGTGGACATGTCTGCCTGATCAGAACGATGTTGTGCAAGCT       c.7200
 Y  K  N  Y  L  H  Q  W  T  C  L  P  D  Q  N  D  V  V  Q  A         p.2400

          .         .        | 54.         .         .         .    g.89141
 AAGAAAGTTTATGAACTGCAAAGTGAG | AATCTATATAAATCTGACCTTGAGTGGCTGAGA    c.7260
 K  K  V  Y  E  L  Q  S  E   | N  L  Y  K  S  D  L  E  W  L  R      p.2420

          .         .         .         .         .         .       g.89201
 GGCATAGGATGGAGTCCCTTGGGTTCTTTAGAGGCAGAAAAGAACAAGCGGGCTTCGGAA       c.7320
 G  I  G  W  S  P  L  G  S  L  E  A  E  K  N  K  R  A  S  E         p.2440

          .         .         .         .         .         .       g.89261
 ATCATCAGTGAGAAGAAATATCGTCAGCCTCCAGACAGAAACAAGTTCACCAGCATTCCT       c.7380
 I  I  S  E  K  K  Y  R  Q  P  P  D  R  N  K  F  T  S  I  P         p.2460

          .         .         .         .         .  | 55      .    g.93262
 GATGCCATGGATATAGTTCTGGCAAAGACAAATGCCAAAAATAGGAGTGAT | AGACTTTAT    c.7440
 D  A  M  D  I  V  L  A  K  T  N  A  K  N  R  S  D   | R  L  Y      p.2480

          .         .         .         .         .         .       g.93322
 AGAGAAGCTTGGGACAAAGACAAGACTCAGATCCACATCATGCCTGATACACCTGACATT       c.7500
 R  E  A  W  D  K  D  K  T  Q  I  H  I  M  P  D  T  P  D  I         p.2500

          .         .         .       | 56 .         .         .    g.94936
 GTTCTGGCTAAAGCAAACTTAATCAACACAAGTGAT | AAACTCTACCGAATGGGTTATGAG    c.7560
 V  L  A  K  A  N  L  I  N  T  S  D   | K  L  Y  R  M  G  Y  E      p.2520

          .         .         .         .         .         .       g.94996
 GAGCTGAAGAGAAAAGGTTACGATCTTCCTGTTGATGCCATACCAATCAAAGCAGCAAAA       c.7620
 E  L  K  R  K  G  Y  D  L  P  V  D  A  I  P  I  K  A  A  K         p.2540

          .         .     | 57   .         .         .         .    g.95394
 GCCTCCCGGGAAATTGCCAGTGAA | TACAAGTACAAGGAAGGCTTTCGCAAGCAGCTCGGC    c.7680
 A  S  R  E  I  A  S  E   | Y  K  Y  K  E  G  F  R  K  Q  L  G      p.2560

          .         .         .         .         .         .       g.95454
 CACCACATTGGTGCCCGGAACATTGAAGATGACCCCAAGATGATGTGGTCCATGCATGTG       c.7740
 H  H  I  G  A  R  N  I  E  D  D  P  K  M  M  W  S  M  H  V         p.2580

          .         .         .         .         .         .       g.95514
 GCCAAGATCCAGAGTGACAGGGAGTACAAGAAGGACTTTGAGAAGTGGAAGACCAAGTTC       c.7800
 A  K  I  Q  S  D  R  E  Y  K  K  D  F  E  K  W  K  T  K  F         p.2600

          .         .         .         .         .         .       g.95574
 AGCAGCCCAGTGGACATGCTGGGGGTGGTGTTGGCCAAGAAGTGCCAGACCTTAGTCAGC       c.7860
 S  S  P  V  D  M  L  G  V  V  L  A  K  K  C  Q  T  L  V  S         p.2620

          .         .         .         .         .         .       g.95634
 GACGTGGACTACAAGAACTACCTGCACCAGTGGACATGCCTGCCCGACCAGAGCGATGTC       c.7920
 D  V  D  Y  K  N  Y  L  H  Q  W  T  C  L  P  D  Q  S  D  V         p.2640

          .         .         .       | 58 .         .         .    g.96158
 ATCCATGCTCGGCAGGCCTATGACCTCCAGAGCGAT | AATTTGTACAAGTCAGACCTTCAG    c.7980
 I  H  A  R  Q  A  Y  D  L  Q  S  D   | N  L  Y  K  S  D  L  Q      p.2660

          .         .         .         .         .         .       g.96218
 TGGCTAAAAGGCATTGGCTGGATGACTAGTGGTTCTCTCGAGGATGAGAAAAATAAACGA       c.8040
 W  L  K  G  I  G  W  M  T  S  G  S  L  E  D  E  K  N  K  R         p.2680

          .         .         .         .         .         .       g.96278
 GCCACCCAGATTTTGAGTGACCATGTTTACCGTCAGCACCCAGATCAATTTAAGTTTTCC       c.8100
 A  T  Q  I  L  S  D  H  V  Y  R  Q  H  P  D  Q  F  K  F  S         p.2700

          .         .         .         .         .         .       g.96338
 AGCCTTATGGATTCCATACCAATGGTTTTGGCAAAAAACAATGCTATTACCATGAATCAT       c.8160
 S  L  M  D  S  I  P  M  V  L  A  K  N  N  A  I  T  M  N  H         p.2720

  | 59       .         .         .         .         .         .    g.96678
  | CGCCTCTATACAGAAGCTTGGGATAAAGATAAAACCACTGTCCACATTATGCCAGATACC    c.8220
  | R  L  Y  T  E  A  W  D  K  D  K  T  T  V  H  I  M  P  D  T      p.2740

          .         .         .         .      | 60  .         .    g.96821
 CCTGAAGTTTTATTAGCTAAACAAAACAAAGTAAATTACAGTGAG | AAATTGTATAAGCTT    c.8280
 P  E  V  L  L  A  K  Q  N  K  V  N  Y  S  E   | K  L  Y  K  L      p.2760

          .         .         .         .         .         .       g.96881
 GGCCTAGAAGAAGCCAAGAGGAAAGGTTATGACATGCGGGTAGATGCCATTCCTATCAAG       c.8340
 G  L  E  E  A  K  R  K  G  Y  D  M  R  V  D  A  I  P  I  K         p.2780

          .         .         .    | 61    .         .         .    g.98848
 GCAGCCAAGGCCTCCAGAGATATTGCAAGTGAA | TTCAAGTACAAAGAAGGCTATCGTAAG    c.8400
 A  A  K  A  S  R  D  I  A  S  E   | F  K  Y  K  E  G  Y  R  K      p.2800

          .         .         .         .         .         .       g.98908
 CAGCTCGGCCACCACATTGGTGCCCGAGCTATACGTGATGACCCCAAGATGATGTGGTCC       c.8460
 Q  L  G  H  H  I  G  A  R  A  I  R  D  D  P  K  M  M  W  S         p.2820

          .         .         .         .         .         .       g.98968
 ATGCACGTGGCCAAGATCCAGAGTGACAGGGAGTACAAGAAGGACTTTGAGAAGTGGAAG       c.8520
 M  H  V  A  K  I  Q  S  D  R  E  Y  K  K  D  F  E  K  W  K         p.2840

          .         .         .         .         .         .       g.99028
 ACCAAGTTCAGCAGCCCAGTGGACATGCTGGGGGTGGTGCTGGCCAAGAAGTGCCAGACC       c.8580
 T  K  F  S  S  P  V  D  M  L  G  V  V  L  A  K  K  C  Q  T         p.2860

          .         .         .         .         .         .       g.99088
 TTAGTCAGCGATGTGGACTACAAGAACTACCTGCACCAGTGGACATGCCTGCCCGACCAG       c.8640
 L  V  S  D  V  D  Y  K  N  Y  L  H  Q  W  T  C  L  P  D  Q         p.2880

          .         .         .         .      | 62  .         .    g.99442
 AGCGACGTCATCCATGCTCGGCAGGCCTATGACCTCCAGAGCGAT | AATATGTACAAGTCT    c.8700
 S  D  V  I  H  A  R  Q  A  Y  D  L  Q  S  D   | N  M  Y  K  S      p.2900

          .         .         .         .         .         .       g.99502
 GATCTCCAGTGGATGAGAGGCATTGGCTGGGTGTCCATTGGCTCTTTGGATGTGGAAAAA       c.8760
 D  L  Q  W  M  R  G  I  G  W  V  S  I  G  S  L  D  V  E  K         p.2920

          .         .         .         .         .         .       g.99562
 TGCAAAAGGGCAACTGAAATTTTGAGTGATAAAATCTATCGCCAGCCTCCAGACAGATTC       c.8820
 C  K  R  A  T  E  I  L  S  D  K  I  Y  R  Q  P  P  D  R  F         p.2940

          .         .         .         .         .         .       g.99622
 AAATTTACCAGTGTGACTGACTCTCTGGAACAAGTGTTGGCCAAAAATAATGCCATCACT       c.8880
 K  F  T  S  V  T  D  S  L  E  Q  V  L  A  K  N  N  A  I  T         p.2960

           | 63        .         .         .         .         .    g.100154
 ATGAACAAG | CGTTTATACACAGAAGCCTGGGACAAAGACAAGACTCAGATCCACATAATG    c.8940
 M  N  K   | R  L  Y  T  E  A  W  D  K  D  K  T  Q  I  H  I  M      p.2980

          .         .         .         .         .     | 64   .    g.103159
 CCAGACACACCAGAAATTATGTTGGCAAGAATGAACAAAATCAACTACAGTGAG | AGTCTG    c.9000
 P  D  T  P  E  I  M  L  A  R  M  N  K  I  N  Y  S  E   | S  L      p.3000

          .         .         .         .         .         .       g.103219
 TACAAACTTGCTAATGAAGAAGCAAAGAAGAAAGGCTATGACTTGCGAAGCGACGCCATC       c.9060
 Y  K  L  A  N  E  E  A  K  K  K  G  Y  D  L  R  S  D  A  I         p.3020

          .         .         .         .   | 65     .         .    g.105540
 CCCATCGTGGCGGCCAAGGCCTCCAGGGACATCATCAGTGAC | TACAAATATAAAGATGGT    c.9120
 P  I  V  A  A  K  A  S  R  D  I  I  S  D   | Y  K  Y  K  D  G      p.3040

          .         .         .         .         .         .       g.105600
 TACTGCAAGCAACTTGGCCACCATATTGGAGCCCGGAACATTGAAGATGACCCCAAGATG       c.9180
 Y  C  K  Q  L  G  H  H  I  G  A  R  N  I  E  D  D  P  K  M         p.3060

          .         .         .         .         .         .       g.105660
 ATGTGGTCCATGCACGTAGCCAAGATCCAGAGTGACAGGGAGTACAAAAAGGACTTTGAG       c.9240
 M  W  S  M  H  V  A  K  I  Q  S  D  R  E  Y  K  K  D  F  E         p.3080

          .         .         .         .         .         .       g.105720
 AAGTGGAAGACCAAGTTCAGCAGCCCAGTGGACATGCTGGGGGTGGTGCTGGCCAAGAAG       c.9300
 K  W  K  T  K  F  S  S  P  V  D  M  L  G  V  V  L  A  K  K         p.3100

          .         .         .         .         .         .       g.105780
 TGCCAGACCTTAGTCAGTGACGTGGACTATAAGAACTACCTGCACGAGTGGACATGCCTG       c.9360
 C  Q  T  L  V  S  D  V  D  Y  K  N  Y  L  H  E  W  T  C  L         p.3120

          .         .         .         .         .     | 66   .    g.108147
 CCTGACCAGAGCGATGTCATCCATGCTCGGCAGGCCTATGACCTCCAGAGTGAC | AATATT    c.9420
 P  D  Q  S  D  V  I  H  A  R  Q  A  Y  D  L  Q  S  D   | N  I      p.3140

          .         .         .         .         .         .       g.108207
 TACAAGTCAGATCTCCAGTGGCTGAGAGGCATTGGCTGGGTCCCCATTGGGTCTATGGAT       c.9480
 Y  K  S  D  L  Q  W  L  R  G  I  G  W  V  P  I  G  S  M  D         p.3160

          .         .         .         .         .         .       g.108267
 GTGGTCAAGTGCAAGAGAGCTACCGAAATACTGAGTGATAACATCTACCGCCAGCCTCCG       c.9540
 V  V  K  C  K  R  A  T  E  I  L  S  D  N  I  Y  R  Q  P  P         p.3180

          .         .         .         .         .         .       g.108327
 GACAAGCTGAAATTTACCAGTGTGACTGATTCTCTAGAGCAGGTGCTGGCCAAGAACAAT       c.9600
 D  K  L  K  F  T  S  V  T  D  S  L  E  Q  V  L  A  K  N  N         p.3200

          .         | 67         .         .         .         .    g.108710
 GCTCTCAACATGAATAAG | CGTTTATACACAGAGGCCTGGGACAAAGACAAGACTCAAATT    c.9660
 A  L  N  M  N  K   | R  L  Y  T  E  A  W  D  K  D  K  T  Q  I      p.3220

          .         .         .         .         .         .       g.108770
 CACATAATGCCTGATACACCAGAGATTATGTTGGCAAGGCAGAACAAAATCAACTACAGT       c.9720
 H  I  M  P  D  T  P  E  I  M  L  A  R  Q  N  K  I  N  Y  S         p.3240

     | 68    .         .         .         .         .         .    g.109898
 GAG | ACTCTATACAAACTTGCCAATGAAGAAGCAAAAAAGAAAGGCTACGACTTGCGAAGT    c.9780
 E   | T  L  Y  K  L  A  N  E  E  A  K  K  K  G  Y  D  L  R  S      p.3260

          .         .         .         .         .  | 69      .    g.111662
 GACGCCATCCCCATCGTGGCTGCCAAGGCCTCCAGGGACGTTATCAGTGAT | TACAAATAC    c.9840
 D  A  I  P  I  V  A  A  K  A  S  R  D  V  I  S  D   | Y  K  Y      p.3280

          .         .         .         .         .         .       g.111722
 AAAGATGGTTACCGCAAGCAGCTCGGCCACCACATTGGAGCCCGGAACATTGAAGATGAC       c.9900
 K  D  G  Y  R  K  Q  L  G  H  H  I  G  A  R  N  I  E  D  D         p.3300

          .         .         .         .         .         .       g.111782
 CCCAAGATGATGTGGTCCATGCATGTGGCCAAGATCCAGAGTGACAGGGAGTATAAGAAG       c.9960
 P  K  M  M  W  S  M  H  V  A  K  I  Q  S  D  R  E  Y  K  K         p.3320

          .         .         .         .         .         .       g.111842
 GACTTTGAGAAGTGGAAGACCAAGTTCAGCAGCCCAGTGGACATGCTGGGAGTGGTGTTA       c.10020
 D  F  E  K  W  K  T  K  F  S  S  P  V  D  M  L  G  V  V  L         p.3340

          .         .         .         .         .         .       g.111902
 GCCAAGAAGTGCCAGACCTTAGTCAGCGATGTGGACTACAAGAACTACCTGCACGAGTGG       c.10080
 A  K  K  C  Q  T  L  V  S  D  V  D  Y  K  N  Y  L  H  E  W         p.3360

          .         .         .         .         .         .       g.111962
 ACGTGCCTGCCCGACCAGAATGATGTCATCCATGCTCGGCAGGCCTATGACCTCCAGAGC       c.10140
 T  C  L  P  D  Q  N  D  V  I  H  A  R  Q  A  Y  D  L  Q  S         p.3380

     | 70    .         .         .         .         .         .    g.112339
 GAT | AACATTTACAAATCTGATCTCCAGTGGCTGAGAGGCATTGGCTGGGTCCCCATTGGG    c.10200
 D   | N  I  Y  K  S  D  L  Q  W  L  R  G  I  G  W  V  P  I  G      p.3400

          .         .         .         .         .         .       g.112399
 TCTATGGATGTGGTCAAGTGCAAGAGAGCTGCTGAAATACTGAGTGATAACATCTACCGC       c.10260
 S  M  D  V  V  K  C  K  R  A  A  E  I  L  S  D  N  I  Y  R         p.3420

          .         .         .         .         .         .       g.112459
 CAGCCTCCGGACAAGCTGAAATTTACCAGTGTGACTGACTCTCTAGAGCAGGTGCTGGCC       c.10320
 Q  P  P  D  K  L  K  F  T  S  V  T  D  S  L  E  Q  V  L  A         p.3440

          .         .        | 71.         .         .         .    g.113882
 AAGAACAATGCTCTCAATATGAACAAG | CGCTTATACACAGAAGCCTGGGACAAAGACAAG    c.10380
 K  N  N  A  L  N  M  N  K   | R  L  Y  T  E  A  W  D  K  D  K      p.3460

          .         .         .         .         .         .       g.113942
 ACCCAAGTCCATATTATGCCTGATACACCTGAAATCATGTTGGCAAGACAAAATAAAATA       c.10440
 T  Q  V  H  I  M  P  D  T  P  E  I  M  L  A  R  Q  N  K  I         p.3480

          .   | 72     .         .         .         .         .    g.118509
 AATTATAGTGAG | AGCCTCTATCGTCAGGCCATGGAAGAAGCCAAGAAAGAAGGCTATGAC    c.10500
 N  Y  S  E   | S  L  Y  R  Q  A  M  E  E  A  K  K  E  G  Y  D      p.3500

          .         .         .         .         .         .       g.118569
 TTGAGAAGTGATGCCATTCCCATTGTGGCTGCCAAGGCCTCTCGGGATATTGCCAGTGAT       c.10560
 L  R  S  D  A  I  P  I  V  A  A  K  A  S  R  D  I  A  S  D         p.3520

  | 73       .         .         .         .         .         .    g.119785
  | TACAAATACAAAGAAGCATATCGTAAACAGTTGGGTCACCACATTGGCGCCCGAGCAGTA    c.10620
  | Y  K  Y  K  E  A  Y  R  K  Q  L  G  H  H  I  G  A  R  A  V      p.3540

          .         .         .         .         .         .       g.119845
 CACGATGACCCCAAGATAATGTGGTCCCTCCACATTGCCAAAGTGCAGAGTGACCGTGAG       c.10680
 H  D  D  P  K  I  M  W  S  L  H  I  A  K  V  Q  S  D  R  E         p.3560

          .         .         .         .         .         .       g.119905
 TACAAGAAAGATTTTGAGAAATACAAGACAAGGTACAGCAGCCCAGTGGACATGCTTGGT       c.10740
 Y  K  K  D  F  E  K  Y  K  T  R  Y  S  S  P  V  D  M  L  G         p.3580

          .         .         .         .         .         .       g.119965
 ATCGTTTTGGCCAAGAAGTGTCAGACCTTGGTCAGCGATGTGGACTATAAACATCCTCTG       c.10800
 I  V  L  A  K  K  C  Q  T  L  V  S  D  V  D  Y  K  H  P  L         p.3600

          .         .         .         .         .         .       g.120025
 CATGAATGGATCTGCCTGCCCGACCAGAATGACATCATTCATGCACGGAAAGCCTATGAC       c.10860
 H  E  W  I  C  L  P  D  Q  N  D  I  I  H  A  R  K  A  Y  D         p.3620

          .   | 74     .         .         .         .         .    g.121057
 CTCCAGAGTGAC | AATTTGTATAAGTCAGACCTTGAATGGATGAAAGGCATTGGCTGGGTT    c.10920
 L  Q  S  D   | N  L  Y  K  S  D  L  E  W  M  K  G  I  G  W  V      p.3640

          .         .         .         .         .         .       g.121117
 CCGATTGATTCCTTGGAAGTTGTTAGGGCCAAGAGAGCTGGAGAATTACTTAGTGATACT       c.10980
 P  I  D  S  L  E  V  V  R  A  K  R  A  G  E  L  L  S  D  T         p.3660

          .         .         .         .         .         .       g.121177
 ATCTACCGTCAGCGTCCAGAAACGCTGAAATTTACCAGTATAACGGACACTCCGGAGCAG       c.11040
 I  Y  R  Q  R  P  E  T  L  K  F  T  S  I  T  D  T  P  E  Q         p.3680

          .         .         .       | 75 .         .         .    g.122043
 GTGCTGGCAAAAAACAATGCTTTAAACATGAATAAG | CGCTTATATACTGAAGCCTGGGAC    c.11100
 V  L  A  K  N  N  A  L  N  M  N  K   | R  L  Y  T  E  A  W  D      p.3700

          .         .         .         .         .         .       g.122103
 AATGACAAGAAAACTATTCATGTCATGCCTGATACACCAGAAATCATGTTAGCCAAACTC       c.11160
 N  D  K  K  T  I  H  V  M  P  D  T  P  E  I  M  L  A  K  L         p.3720

          .         .  | 76      .         .         .         .    g.123417
 AACCGAATAAACTACAGTGAT | AAACTCTATAAACTTGCTTTGGAAGAGTCCAAGAAGGAA    c.11220
 N  R  I  N  Y  S  D   | K  L  Y  K  L  A  L  E  E  S  K  K  E      p.3740

          .         .         .         .         .         .       g.123477
 GGCTATGACTTGCGTCTGGATGCCATTCCAATCCAAGCAGCCAAGGCTTCAAGAGATATT       c.11280
 G  Y  D  L  R  L  D  A  I  P  I  Q  A  A  K  A  S  R  D  I         p.3760

           | 77        .         .         .         .         .    g.124951
 GCTAGTGAT | TACAAGTACAAGGAAGGCTACCGCAAACAGCTTGGCCACCATATTGGGGCC    c.11340
 A  S  D   | Y  K  Y  K  E  G  Y  R  K  Q  L  G  H  H  I  G  A      p.3780

          .         .         .         .         .         .       g.125011
 CGGAACATTAAGGATGACCCGAAGATGATGTGGTCCATCCATGTGGCCAAGATCCAGAGT       c.11400
 R  N  I  K  D  D  P  K  M  M  W  S  I  H  V  A  K  I  Q  S         p.3800

          .         .         .         .         .         .       g.125071
 GACAGGGAGTACAAGAAGGAGTTTGAGAAGTGGAAGACCAAGTTCAGCAGCCCAGTGGAC       c.11460
 D  R  E  Y  K  K  E  F  E  K  W  K  T  K  F  S  S  P  V  D         p.3820

          .         .         .         .         .         .       g.125131
 ATGCTGGGGGTGGTGCTGGCCAAGAAGTGTCAGATCCTTGTAAGCGACATAGACTACAAG       c.11520
 M  L  G  V  V  L  A  K  K  C  Q  I  L  V  S  D  I  D  Y  K         p.3840

          .         .         .         .         .         .       g.125191
 CATCCCCTGCATGAATGGACCTGCCTGCCTGATCAGAATGACGTCATTCAGGCTCGGAAG       c.11580
 H  P  L  H  E  W  T  C  L  P  D  Q  N  D  V  I  Q  A  R  K         p.3860

          .         .  | 78      .         .         .         .    g.127137
 GCCTATGACCTGCAGAGTGAT | GCTATTTACAAATCTGATCTTGAGTGGCTGAGAGGCATA    c.11640
 A  Y  D  L  Q  S  D   | A  I  Y  K  S  D  L  E  W  L  R  G  I      p.3880

          .         .         .         .         .         .       g.127197
 GGATGGGTTCCCATTGGCTCTGTAGAGGTCGAGAAAGTGAAGAGAGCTGGAGAAATCCTG       c.11700
 G  W  V  P  I  G  S  V  E  V  E  K  V  K  R  A  G  E  I  L         p.3900

          .         .         .         .         .         .       g.127257
 AGTGACAGGAAGTATCGCCAGCCTGCAGACCAGCTCAAATTCACATGCATTACCGACACT       c.11760
 S  D  R  K  Y  R  Q  P  A  D  Q  L  K  F  T  C  I  T  D  T         p.3920

          .         .         .         .      | 79  .         .    g.128636
 CCGGAAATTGTCCTAGCAAAGAATAATGCCCTGACAATGAGCAAG | CATTTATACACAGAA    c.11820
 P  E  I  V  L  A  K  N  N  A  L  T  M  S  K   | H  L  Y  T  E      p.3940

          .         .         .         .         .         .       g.128696
 GCTTGGGATGCTGACAAAACCTCCATCCACGTGATGCCAGACACCCCAGATATCCTGCTG       c.11880
 A  W  D  A  D  K  T  S  I  H  V  M  P  D  T  P  D  I  L  L         p.3960

          .         .         . | 80       .         .         .    g.128894
 GCCAAGAGTAATTCTGCCAATATCAGCCAA | AAACTTTACACCAAGGGATGGGATGAATCA    c.11940
 A  K  S  N  S  A  N  I  S  Q   | K  L  Y  T  K  G  W  D  E  S      p.3980

          .         .         .         .         .         .       g.128954
 AAGATGAAGGACTATGATCTGAGAGCAGATGCTATTTCCATCAAAAGTGCCAAGGCCTCC       c.12000
 K  M  K  D  Y  D  L  R  A  D  A  I  S  I  K  S  A  K  A  S         p.4000

          .         | 81         .         .         .         .    g.129409
 AGGGACATCGCCAGTGAC | TACAAATACAAGGAAGCCTATGAGAAACAGAAAGGCCACCAC    c.12060
 R  D  I  A  S  D   | Y  K  Y  K  E  A  Y  E  K  Q  K  G  H  H      p.4020

          .         .         .         .         .         .       g.129469
 ATTGGAGCCCAGAGCATTGAAGATGATCCCAAGATTATGTGTGCCATACATGCAGGAAAA       c.12120
 I  G  A  Q  S  I  E  D  D  P  K  I  M  C  A  I  H  A  G  K         p.4040

          .         .         .         .         .         .       g.129529
 ATTCAAAGTGAAAGGGAGTACAAGAAGGAATTCCAAAAGTGGAAAACCAAGTTCTCTAGC       c.12180
 I  Q  S  E  R  E  Y  K  K  E  F  Q  K  W  K  T  K  F  S  S         p.4060

          .         .         .         .         .         .       g.129589
 CCAGTGGACATGTTAAGCATCTTGCTGGCCAAGAAATGTCAGACTTTGGTCACTGACATT       c.12240
 P  V  D  M  L  S  I  L  L  A  K  K  C  Q  T  L  V  T  D  I         p.4080

          .         .         .         .         .         .       g.129649
 GATTATCGCAATTACCTGCATGAATGGACATGCATGCCGGATCAAAACGACATTATCCAA       c.12300
 D  Y  R  N  Y  L  H  E  W  T  C  M  P  D  Q  N  D  I  I  Q         p.4100

          .         .         . | 82       .         .         .    g.130841
 GCAAAAAAGGCCTATGACCTGCAGAGTGAT | AGTGTGTATAAGGCAGACCTGGAGTGGCTG    c.12360
 A  K  K  A  Y  D  L  Q  S  D   | S  V  Y  K  A  D  L  E  W  L      p.4120
                                ^  sequence block 1

          .         .         .         .         .         .       g.130901
 CGTGGCATCGGCTGGATGCCAGAAGGCTCAGTGGAAATGAACAGAGTGAAGGTTGCTCAA       c.12420
 R  G  I  G  W  M  P  E  G  S  V  E  M  N  R  V  K  V  A  Q         p.4140

          .         .         .         .         .         .       g.130961
 GACCTCGTGAATGAAAGACTCTATAGGACACGTCCAGAAGCTTTGTCATTCACCAGCATT       c.12480
 D  L  V  N  E  R  L  Y  R  T  R  P  E  A  L  S  F  T  S  I         p.4160

          .         .         .         .         .     | 83   .    g.131885
 GTCGACACTCCAGAAGTTGTCTTGGCAAAAGCCAATTCTCTGCAAATAAGTGAG | AAACTG    c.12540
 V  D  T  P  E  V  V  L  A  K  A  N  S  L  Q  I  S  E   | K  L      p.4180

          .         .         .         .         .         .       g.131945
 TATCAGGAAGCCTGGAATAAAGATAAAAGCAACATCACCATTCCTTCTGATACTCCGGAG       c.12600
 Y  Q  E  A  W  N  K  D  K  S  N  I  T  I  P  S  D  T  P  E         p.4200

          .         .         .          | 84        .         .    g.132795
 ATGCTGCAGGCCCACATCAATGCCTTGCAAATCAGCAAT | AAACTCTACCAAAAAGACTGG    c.12660
 M  L  Q  A  H  I  N  A  L  Q  I  S  N   | K  L  Y  Q  K  D  W      p.4220

          .         .         .         .         .         .       g.132855
 AATGACGCCAAGCAGAAAGGCTATGACATAAGGGCAGATGCCATTGAAATCAAGCACGCC       c.12720
 N  D  A  K  Q  K  G  Y  D  I  R  A  D  A  I  E  I  K  H  A         p.4240

          .         .        | 85.         .         .         .    g.134649
 AAGGCCTCCAGAGAAATTGCCAGTGAG | TACAAATACAAAGAAGGTTACCGTAAGCAACTG    c.12780
 K  A  S  R  E  I  A  S  E   | Y  K  Y  K  E  G  Y  R  K  Q  L      p.4260

          .         .         .         .         .         .       g.134709
 GGCCACCACATGGGTTTCCGCACCCTACAAGATGACCCCAAGTCAGTATGGGCTATACAT       c.12840
 G  H  H  M  G  F  R  T  L  Q  D  D  P  K  S  V  W  A  I  H         p.4280

          .         .         .         .         .         .       g.134769
 GCTGCCAAGATCCAGAGTGACAGAGAATATAAGAAAGCTTATGAGAAGTCTAAAGGAATT       c.12900
 A  A  K  I  Q  S  D  R  E  Y  K  K  A  Y  E  K  S  K  G  I         p.4300

          .         .         .         .         .         .       g.134829
 CACAACACACCGTTGGACATGATGTCAATTGTTCAAGCCAAGAAATGCCAGGTCCTGGTT       c.12960
 H  N  T  P  L  D  M  M  S  I  V  Q  A  K  K  C  Q  V  L  V         p.4320

          .         .         .         .         .         .       g.134889
 AGCGACATTGATTATCGCAATTATCTGCACCAGTGGACGTGTCTGCCAGATCAGAACGAT       c.13020
 S  D  I  D  Y  R  N  Y  L  H  Q  W  T  C  L  P  D  Q  N  D         p.4340

          .         .         .          | 86        .         .    g.135736
 GTGATCCAGGCCAAGAAAGCCTACGACCTGCAGAGCGAT | AACTTGTACAAGTCAGACCTG    c.13080
 V  I  Q  A  K  K  A  Y  D  L  Q  S  D   | N  L  Y  K  S  D  L      p.4360

          .         .         .         .         .         .       g.135796
 GAATGGCTGAAGGGTATTGGATGGCTGCCAGAGGGTTCTGTGGAAGTGATGAGAGTGAAG       c.13140
 E  W  L  K  G  I  G  W  L  P  E  G  S  V  E  V  M  R  V  K         p.4380

          .         .         .         .         .         .       g.135856
 AATGCCCAGAATCTCTTGAATGAAAGGCTGTATCGTATAAAGCCTGAGGCCCTCAAATTC       c.13200
 N  A  Q  N  L  L  N  E  R  L  Y  R  I  K  P  E  A  L  K  F         p.4400

          .         .         .         .         .         .       g.135916
 ACCAGCATTGTTGACACCCCGGAAGTAATCCAGGCAAAGATCAATGCTGTACAGATCAGT       c.13260
 T  S  I  V  D  T  P  E  V  I  Q  A  K  I  N  A  V  Q  I  S         p.4420

     | 87    .         .         .         .         .         .    g.136853
 GAG | CCATTGTATCGCGATGCCTGGGAGAAAGAGAAGGCTAATGTGAACGTGCCAGCTGAC    c.13320
 E   | P  L  Y  R  D  A  W  E  K  E  K  A  N  V  N  V  P  A  D      p.4440

          .         .         .         .         | 88         .    g.137491
 ACTCCCCTGATGCTGCAATCCAAAATCAATGCCCTGCAGATCAGCAAT | AAACGCTATCAG    c.13380
 T  P  L  M  L  Q  S  K  I  N  A  L  Q  I  S  N   | K  R  Y  Q      p.4460

          .         .         .         .         .         .       g.137551
 CAAGCTTGGGAAGATGTCAAGATGACTGGTTATGACCTGCGAGCAGATGCCATTGGGATC       c.13440
 Q  A  W  E  D  V  K  M  T  G  Y  D  L  R  A  D  A  I  G  I         p.4480

          .         .         .       | 89 .         .         .    g.138758
 CAGCATGCCAAGGCTTCCAGGGATATTGCCAGTGAC | TATCTGTACAAAACTGCTTATGAG    c.13500
 Q  H  A  K  A  S  R  D  I  A  S  D   | Y  L  Y  K  T  A  Y  E      p.4500

          .         .         .         .         .         .       g.138818
 AAACAGAAAGGCCATTACATTGGCTGTCGCAGCGCCAAGGAAGACCCTAAACTGGTTTGG       c.13560
 K  Q  K  G  H  Y  I  G  C  R  S  A  K  E  D  P  K  L  V  W         p.4520

          .         .         .         .         .         .       g.138878
 GCAGCAAATGTGTTGAAGATGCAGAATGACAGGCTGTACAAAAAGGCCTACAACGACCAC       c.13620
 A  A  N  V  L  K  M  Q  N  D  R  L  Y  K  K  A  Y  N  D  H         p.4540

          .         .         .         .         .         .       g.138938
 AAAGCCAAGATCTCCATCCCTGTGGACATGGTGTCCATCAGCGCTGCCAAAGAAGGTCAG       c.13680
 K  A  K  I  S  I  P  V  D  M  V  S  I  S  A  A  K  E  G  Q         p.4560

          .         .         .         .         .         .       g.138998
 GCACTGGCAAGTGATGTGGACTATCGCCATTACCTGCACCACTGGTCTTGCTTTCCCGAC       c.13740
 A  L  A  S  D  V  D  Y  R  H  Y  L  H  H  W  S  C  F  P  D         p.4580

          .         .         .         .         | 90         .    g.141369
 CAGAATGATGTGATCCAAGCCAGGAAAGCCTACGACCTACAGAGCGAC | AGTGTGTATAAG    c.13800
 Q  N  D  V  I  Q  A  R  K  A  Y  D  L  Q  S  D   | S  V  Y  K      p.4600
                                                  ^  sequence block 2

          .         .         .         .         .         .       g.141429
 GCAGACCTGGAGTGGCTGCGTGGCATCGGCTGGATGCCAGAAGGCTCAGTGGAAATGAAC       c.13860
 A  D  L  E  W  L  R  G  I  G  W  M  P  E  G  S  V  E  M  N         p.4620

          .         .         .         .         .         .       g.141489
 AGAGTGAAGGTTGCTCAAGACCTCGTGAATGAAAGACTCTATAGGACACGTCCAGAAGCT       c.13920
 R  V  K  V  A  Q  D  L  V  N  E  R  L  Y  R  T  R  P  E  A         p.4640

          .         .         .         .         .         .       g.141549
 TTGTCATTCACCAGCATTGTCGACACTCCAGAAGTTGTCTTGGCAAAAGCCAATTCTCTG       c.13980
 L  S  F  T  S  I  V  D  T  P  E  V  V  L  A  K  A  N  S  L         p.4660

          .   | 91     .         .         .         .         .    g.142473
 CAAATAAGTGAG | AAACTGTATCAGGAAGCCTGGAATAAAGATAAAAGCAACATCACCATT    c.14040
 Q  I  S  E   | K  L  Y  Q  E  A  W  N  K  D  K  S  N  I  T  I      p.4680

          .         .         .         .         .        | 92.    g.143323
 CCTTCTGATACTCCGGAGATGCTGCAGGCCCACATCAATGCCTTGCAAATCAGCAAT | AAA    c.14100
 P  S  D  T  P  E  M  L  Q  A  H  I  N  A  L  Q  I  S  N   | K      p.4700

          .         .         .         .         .         .       g.143383
 CTCTACCAAAAAGACTGGAATGACACCAAGCAGAAAGGCTATGACATAAGGGCAGATGCC       c.14160
 L  Y  Q  K  D  W  N  D  T  K  Q  K  G  Y  D  I  R  A  D  A         p.4720

          .         .         .         .      | 93  .         .    g.145184
 ATTGAAATCAAGCACGCCAAGGCCTCCAGAGAAATTGCCAGTGAG | TACAAATACAAAGAA    c.14220
 I  E  I  K  H  A  K  A  S  R  E  I  A  S  E   | Y  K  Y  K  E      p.4740

          .         .         .         .         .         .       g.145244
 GGTTACCGTAAGCAACTGGGCCACCACATGGGTTTCCGCACCCTACAAGATGACCCCAAG       c.14280
 G  Y  R  K  Q  L  G  H  H  M  G  F  R  T  L  Q  D  D  P  K         p.4760

          .         .         .         .         .         .       g.145304
 TCAGTATGGGCTATACATGCTGCCAAGATCCAGAGTGACAGAGAATATAAGAAAGCTTAT       c.14340
 S  V  W  A  I  H  A  A  K  I  Q  S  D  R  E  Y  K  K  A  Y         p.4780

          .         .         .         .         .         .       g.145364
 GAGAAGTCTAAAGGAATTCACAACACACCGTTGGACATGATGTCAATTGTTCAAGCCAAG       c.14400
 E  K  S  K  G  I  H  N  T  P  L  D  M  M  S  I  V  Q  A  K         p.4800

          .         .         .         .         .         .       g.145424
 AAATGCCAGGTCCTGGTTAGCGACATTGATTATCGCAATTATCTGCACCAGTGGACGTGT       c.14460
 K  C  Q  V  L  V  S  D  I  D  Y  R  N  Y  L  H  Q  W  T  C         p.4820

          .         .         .         .         .        | 94.    g.146271
 CTGCCAGATCAGAACGATGTGATCCAGGCCAAGAAAGCCTACGACCTGCAGAGCGAT | AAC    c.14520
 L  P  D  Q  N  D  V  I  Q  A  K  K  A  Y  D  L  Q  S  D   | N      p.4840

          .         .         .         .         .         .       g.146331
 TTGTACAAGTCAGACCTGGAATGGCTGAAGGGTATTGGATGGTTGCCAGAGGGTTCTGTG       c.14580
 L  Y  K  S  D  L  E  W  L  K  G  I  G  W  L  P  E  G  S  V         p.4860

          .         .         .         .         .         .       g.146391
 GAAGTGATGAGAGTGAAGAATGCCCAGAATCTCTTGAATGAAAGGCTGTATCGTATAAAG       c.14640
 E  V  M  R  V  K  N  A  Q  N  L  L  N  E  R  L  Y  R  I  K         p.4880

          .         .         .         .         .         .       g.146451
 CCTGAGGCCCTCAAATTCACCAGCATTGTTGACACCCCGGAAGTAATCCAGGCAAAGATC       c.14700
 P  E  A  L  K  F  T  S  I  V  D  T  P  E  V  I  Q  A  K  I         p.4900

          .         .  | 95      .         .         .         .    g.147388
 AATGCTGTACAGATCAGTGAG | CCATTGTATCGCAATGCCTGGGAGAAAGAGAAGGCTAAT    c.14760
 N  A  V  Q  I  S  E   | P  L  Y  R  N  A  W  E  K  E  K  A  N      p.4920

          .         .         .         .         .         .       g.147448
 GTGAACGTGCCAGCTGACACTCCCCTGATGCTGCAATCCAAAATCAATGCTCTGCAGATC       c.14820
 V  N  V  P  A  D  T  P  L  M  L  Q  S  K  I  N  A  L  Q  I         p.4940

        | 96 .         .         .         .         .         .    g.148086
 AGCAAT | AAACGCTATCAGCAAGCTTGGGAAGATGTCAAGATGACTGGTTATGACCTGCGA    c.14880
 S  N   | K  R  Y  Q  Q  A  W  E  D  V  K  M  T  G  Y  D  L  R      p.4960

          .         .         .         .         .     | 97   .    g.149293
 GCAGATGCCATTGGGATCCAGCATGCCAAGGCTTCCAGGGATATTGCCAGTGAT | TATCTG    c.14940
 A  D  A  I  G  I  Q  H  A  K  A  S  R  D  I  A  S  D   | Y  L      p.4980

          .         .         .         .         .         .       g.149353
 TACAAAACTGCTTATGAGAAACAGAAAGGCCATTACATTGGCTGTCGCAGCGCCAAGGAA       c.15000
 Y  K  T  A  Y  E  K  Q  K  G  H  Y  I  G  C  R  S  A  K  E         p.5000

          .         .         .         .         .         .       g.149413
 GACCCTAAACTGGTTTGGGCAGCAAATGTGTTGAAGATGCAGAATGACAGGCTGTACAAA       c.15060
 D  P  K  L  V  W  A  A  N  V  L  K  M  Q  N  D  R  L  Y  K         p.5020

          .         .         .         .         .         .       g.149473
 AAGGCCTACAACGACCACAAAGCCAAGATCTCCATCCCTGTGGACATGGTGTCCATCAGC       c.15120
 K  A  Y  N  D  H  K  A  K  I  S  I  P  V  D  M  V  S  I  S         p.5040

          .         .         .         .         .         .       g.149533
 GCTGCCAAAGAAGGTCAGGCACTGGCAAGTGATGTGGACTATCGCCATTACCTGCACCAC       c.15180
 A  A  K  E  G  Q  A  L  A  S  D  V  D  Y  R  H  Y  L  H  H         p.5060

          .         .         .         .         .         .       g.149593
 TGGTCTTGCTTTCCCGACCAGAATGATGTGATCCAAGCCAGGAAAGCCTACGACCTACAG       c.15240
 W  S  C  F  P  D  Q  N  D  V  I  Q  A  R  K  A  Y  D  L  Q         p.5080

        | 98 .         .         .         .         .         .    g.151964
 AGCGAC | AGTGTGTATAAGGCAGACCTGGAGTGGCTGCGTGGCATCGGCTGGATGCCAGAA    c.15300
 S  D   | S  V  Y  K  A  D  L  E  W  L  R  G  I  G  W  M  P  E      p.5100
        ^  sequence block 3

          .         .         .         .         .         .       g.152024
 GGCTCAGTGGAAATGAACAGAGTGAAGGTTGCTCAAGACCTCGTGAATGAAAGACTCTAT       c.15360
 G  S  V  E  M  N  R  V  K  V  A  Q  D  L  V  N  E  R  L  Y         p.5120

          .         .         .         .         .         .       g.152084
 AGGACACGTCCAGAAGCTTTGTCATTCACCAGCATTGTCGACACTCCAGAAGTTGTCTTG       c.15420
 R  T  R  P  E  A  L  S  F  T  S  I  V  D  T  P  E  V  V  L         p.5140

          .         .         . | 99       .         .         .    g.153008
 GCAAAAGCCAATTCTCTGCAAATAAGTGAG | AAACTGTATCAGGAAGCCTGGAATAAAGAT    c.15480
 A  K  A  N  S  L  Q  I  S  E   | K  L  Y  Q  E  A  W  N  K  D      p.5160

          .         .         .         .         .         .       g.153068
 AAAAGCAACATCACCATTCCTTCTGATACTCCGGAGATGCTGCAGGCCCACATCAATGCC       c.15540
 K  S  N  I  T  I  P  S  D  T  P  E  M  L  Q  A  H  I  N  A         p.5180

          .      | 100 .         .         .         .         .    g.153918
 TTGCAAATCAGCAAT | AAACTCTACCAAAAAGACTGGAATGACACCAAGCAGAAAGGCTAT    c.15600
 L  Q  I  S  N   | K  L  Y  Q  K  D  W  N  D  T  K  Q  K  G  Y      p.5200

          .         .         .         .         .         .       g.153978
 GACATAAGGGCAGATGCCATTGAAATCAAGCACGCCAAGGCCTCCAGAGAAATTGCCAGT       c.15660
 D  I  R  A  D  A  I  E  I  K  H  A  K  A  S  R  E  I  A  S         p.5220

     | 101   .         .         .         .         .         .    g.155778
 GAG | TACAAATACAAAGAAGGTTACCGTAAGCAACTGGGCCACCACATGGGTTTCCGCACC    c.15720
 E   | Y  K  Y  K  E  G  Y  R  K  Q  L  G  H  H  M  G  F  R  T      p.5240

          .         .         .         .         .         .       g.155838
 CTACAAGATGACCCCAAGTCAGTATGGGCTATACATGCTGCCAAGATCCAGAGTGACAGA       c.15780
 L  Q  D  D  P  K  S  V  W  A  I  H  A  A  K  I  Q  S  D  R         p.5260

          .         .         .         .         .         .       g.155898
 GAATATAAGAAAGCTTATGAGAAGTCTAAAGGAATTCACAACACACCGTTGGACATGATG       c.15840
 E  Y  K  K  A  Y  E  K  S  K  G  I  H  N  T  P  L  D  M  M         p.5280

          .         .         .         .         .         .       g.155958
 TCAATTGTTCAAGCCAAGAAATGCCAGGTCCTGGTTAGCGACATTGATTATCGCAATTAT       c.15900
 S  I  V  Q  A  K  K  C  Q  V  L  V  S  D  I  D  Y  R  N  Y         p.5300

          .         .         .         .         .         .       g.156018
 CTGCACCAGTGGACGTGTCTGCCAGATCAGAACGATGTGATCCAGGCCAAGAAAGCCTAC       c.15960
 L  H  Q  W  T  C  L  P  D  Q  N  D  V  I  Q  A  K  K  A  Y         p.5320

          .      | 102 .         .         .         .         .    g.156865
 GACCTGCAGAGCGAT | AACTTGTACAAGTCAGACCTGGAATGGCTGAAGGGTATTGGATGG    c.16020
 D  L  Q  S  D   | N  L  Y  K  S  D  L  E  W  L  K  G  I  G  W      p.5340

          .         .         .         .         .         .       g.156925
 TTGCCAGAGGGTTCTGTGGAAGTGATGAGAGTGAAGAATGCCCAGAATCTCTTGAATGAA       c.16080
 L  P  E  G  S  V  E  V  M  R  V  K  N  A  Q  N  L  L  N  E         p.5360

          .         .         .         .         .         .       g.156985
 AGGCTGTATCGTATAAAGCCTGAGGCCCTCAAATTCACCAGCATTGTTGACACCCCGGAA       c.16140
 R  L  Y  R  I  K  P  E  A  L  K  F  T  S  I  V  D  T  P  E         p.5380

          .         .         .          | 103       .         .    g.157921
 GTAATCCAGGCAAAGATCAATGCTGTACAGATCAGTGAG | CCATTGTATCGCGATGCCTGG    c.16200
 V  I  Q  A  K  I  N  A  V  Q  I  S  E   | P  L  Y  R  D  A  W      p.5400

          .         .         .         .         .         .       g.157981
 GAGAAAGAGAAGGCTAATGTGAACGTGCCAGCTGACACTCCCCTGATGCTGCAATCCAAA       c.16260
 E  K  E  K  A  N  V  N  V  P  A  D  T  P  L  M  L  Q  S  K         p.5420

          .         .     | 104  .         .         .         .    g.158619
 ATCAATGCCCTGCAGATCAGCAAT | AAACGCTATCAGCAAGCTTGGGAAGATGTCAAGATG    c.16320
 I  N  A  L  Q  I  S  N   | K  R  Y  Q  Q  A  W  E  D  V  K  M      p.5440

          .         .         .         .         .         .       g.158679
 ACTGGTTATGACCTGCGAGCAGATGCCATTGGGATCCAGCATGCCAAGGCTTCCAGGGAT       c.16380
 T  G  Y  D  L  R  A  D  A  I  G  I  Q  H  A  K  A  S  R  D         p.5460

          .   | 105    .         .         .         .         .    g.159886
 ATTGCCAGTGAC | TATCTGTACAAAACTGCTTATGAGAAACAGAAAGGCCATTACATTGGC    c.16440
 I  A  S  D   | Y  L  Y  K  T  A  Y  E  K  Q  K  G  H  Y  I  G      p.5480

          .         .         .         .         .         .       g.159946
 TGTCGCAGCGCCAAGGAAGACCCTAAACTGGTTTGGGCAGCAAATGTGTTGAAGATGCAG       c.16500
 C  R  S  A  K  E  D  P  K  L  V  W  A  A  N  V  L  K  M  Q         p.5500

          .         .         .         .         .         .       g.160006
 AATGACAGGCTGTACAAAAAGGCCTACAACGACCACAAAGCCAAGATCTCCATCCCTGTG       c.16560
 N  D  R  L  Y  K  K  A  Y  N  D  H  K  A  K  I  S  I  P  V         p.5520

          .         .         .         .         .         .       g.160066
 GACATGGTGTCCATCAGCGCTGCCAAAGAAGGTCAGGCACTGGCAAGTGATGTGGACTAT       c.16620
 D  M  V  S  I  S  A  A  K  E  G  Q  A  L  A  S  D  V  D  Y         p.5540

          .         .         .         .         .         .       g.160126
 CGCCATTACCTGCACCGCTGGTCTTGCTTTCCCGACCAGAATGATGTGATCCAAGCCAGG       c.16680
 R  H  Y  L  H  R  W  S  C  F  P  D  Q  N  D  V  I  Q  A  R         p.5560

          .         .     | 106  .         .         .         .    g.163169
 AAAGCCTACGACCTACAGAGCGAC | GCCCTCTACAAGGCTGACTTGGAGTGGTTGCGTGGC    c.16740
 K  A  Y  D  L  Q  S  D   | A  L  Y  K  A  D  L  E  W  L  R  G      p.5580

          .         .         .         .         .         .       g.163229
 ATTGGCTGGATGCCCCAAGGGTCTCCTGAAGTGTTGAGAGTCAAAAACGCCCAGAATATC       c.16800
 I  G  W  M  P  Q  G  S  P  E  V  L  R  V  K  N  A  Q  N  I         p.5600

          .         .         .         .         .         .       g.163289
 TTTTGTGACAGTGTCTATCGGACGCCTGTGGTGAACCTTAAGTACACAAGCATTGTTGAC       c.16860
 F  C  D  S  V  Y  R  T  P  V  V  N  L  K  Y  T  S  I  V  D         p.5620

          .         .         .         .         | 107        .    g.163700
 ACACCTGAAGTGGTCCTTGCTAAATCAAATGCTGAAAATATTAGTATT | CCAAAGTACAGA    c.16920
 T  P  E  V  V  L  A  K  S  N  A  E  N  I  S  I   | P  K  Y  R      p.5640

          .         .         .         .         .         .       g.163760
 GAGGTTTGGGACAAGGATAAAACTTCAATACACATAATGCCAGATACTCCAGAAATTAAT       c.16980
 E  V  W  D  K  D  K  T  S  I  H  I  M  P  D  T  P  E  I  N         p.5660

          .         .         .    | 108   .         .         .    g.168913
 CTCGCTAGAGCAAATGCTCTTAATGTGAGCAAT | AAACTTTACCGTGAGGGCTGGGATGAA    c.17040
 L  A  R  A  N  A  L  N  V  S  N   | K  L  Y  R  E  G  W  D  E      p.5680

          .         .         .         .         .         .       g.168973
 ATGAAGGCGGGCTGTGATGTCCGGCTGGATGCCATCCCCATCCAGGCTGCCAAGGCCTCC       c.17100
 M  K  A  G  C  D  V  R  L  D  A  I  P  I  Q  A  A  K  A  S         p.5700

          .         | 109        .         .         .         .    g.169137
 AGGGAGATTGCCAGTGAC | TATAAATATAAGCTTGACCATGAGAAGCAGAAGGGACACTAC    c.17160
 R  E  I  A  S  D   | Y  K  Y  K  L  D  H  E  K  Q  K  G  H  Y      p.5720

          .         .         .         .         .         .       g.169197
 GTGGGCACCCTCACAGCCAGGGATGACAACAAGATCCGCTGGGCCCTCATAGCTGACAAG       c.17220
 V  G  T  L  T  A  R  D  D  N  K  I  R  W  A  L  I  A  D  K         p.5740

          .         .         .         .         .         .       g.169257
 CTCCAGAATGAACGAGAGTACCGGCTGGACTGGGCCAAATGGAAGGCCAAGATCCAGAGC       c.17280
 L  Q  N  E  R  E  Y  R  L  D  W  A  K  W  K  A  K  I  Q  S         p.5760

          .         .         .         .         .         .       g.169317
 CCTGTGGACATGCTTTCCATCCTGCACTCTAAAAATTCCCAGGCTCTGGTCAGTGACATG       c.17340
 P  V  D  M  L  S  I  L  H  S  K  N  S  Q  A  L  V  S  D  M         p.5780

          .         .         .         .         .         .       g.169377
 GATTACCGCAATTACCTGCACCAGTGGACCTGCATGCCCGACCAGAACGATGTGATTCAG       c.17400
 D  Y  R  N  Y  L  H  Q  W  T  C  M  P  D  Q  N  D  V  I  Q         p.5800

          .         .         . | 110      .         .         .    g.170145
 GCCAAGAAGGCCTACGAACTGCAGAGCGAT | AATGTTTACAAGGCTGACTTGGAATGGTTG    c.17460
 A  K  K  A  Y  E  L  Q  S  D   | N  V  Y  K  A  D  L  E  W  L      p.5820

          .         .         .         .         .         .       g.170205
 CGTGGAATTGGGTGGATGCCAAATGACTCCGTGTCCGTCAATCATGCCAAACATGCCGCG       c.17520
 R  G  I  G  W  M  P  N  D  S  V  S  V  N  H  A  K  H  A  A         p.5840

          .      | 111 .         .         .         .         .    g.170816
 GACATCTTCAGTGAG | AAAAAATATCGCACAAAAATAGAAACTCTCAACTTTACGCCTGTG    c.17580
 D  I  F  S  E   | K  K  Y  R  T  K  I  E  T  L  N  F  T  P  V      p.5860

          .         .         .         .         .     | 112  .    g.171076
 GATGACAGAGTTGATTATGTGACAGCGAAACAAAGTGGCGAGATCCTCGATGAT | ATTAAA    c.17640
 D  D  R  V  D  Y  V  T  A  K  Q  S  G  E  I  L  D  D   | I  K      p.5880

          .         .         .         .         .         .       g.171136
 TACCGGAAAGACTGGAATGCCACCAAATCAAAGTACACCCTCACAGAAACCCCCCTGCTG       c.17700
 Y  R  K  D  W  N  A  T  K  S  K  Y  T  L  T  E  T  P  L  L         p.5900

          .         .         .       | 113.         .         .    g.171333
 CACACTGCCCAGGAGGCTGCTAGGATACTGGACCAG | TATCTCTACAAGGAAGGCTGGGAG    c.17760
 H  T  A  Q  E  A  A  R  I  L  D  Q   | Y  L  Y  K  E  G  W  E      p.5920

          .         .         .         .         .         .       g.171393
 AGACAAAAAGCCACAGGTTACATTTTGCCTCCAGATGCTGTGCCATTTGTTCATGCCCAT       c.17820
 R  Q  K  A  T  G  Y  I  L  P  P  D  A  V  P  F  V  H  A  H         p.5940

          .         .     | 114  .         .         .         .    g.172044
 CACTGCAATGACGTTCAGAGTGAG | CTGAAATACAAAGCTGAACATGTGAAGCAAAAAGGT    c.17880
 H  C  N  D  V  Q  S  E   | L  K  Y  K  A  E  H  V  K  Q  K  G      p.5960

          .         .         .         .         .         .       g.172104
 CATTATGTTGGTGTCCCGACGATGAGAGATGATCCTAAGCTGGTTTGGTTTGAGCATGCA       c.17940
 H  Y  V  G  V  P  T  M  R  D  D  P  K  L  V  W  F  E  H  A         p.5980

          .         .         .         .         .         .       g.172164
 GGCCAGATTCAGAATGAGAGACTATACAAAGAGGACTATCACAAAACAAAGGCCAAAATC       c.18000
 G  Q  I  Q  N  E  R  L  Y  K  E  D  Y  H  K  T  K  A  K  I         p.6000

          .         .         .         .         .         .       g.172224
 AATATACCTGCTGATATGGTGTCAGTCTTGGCCGCCAAGCAGGGGCAGACCCTTGTCAGT       c.18060
 N  I  P  A  D  M  V  S  V  L  A  A  K  Q  G  Q  T  L  V  S         p.6020

          .         .         .         .         .         .       g.172284
 GATATTGATTATCGTAATTACTTGCACCAATGGATGTGTCATCCTGACCAGAACGATGTT       c.18120
 D  I  D  Y  R  N  Y  L  H  Q  W  M  C  H  P  D  Q  N  D  V         p.6040

          .         .         .       | 115.         .         .    g.173691
 ATTCAGGCAAGAAAGGCCTATGACCTACAGAGTGAT | AATGTCTACAGAGCTGACCTGGAG    c.18180
 I  Q  A  R  K  A  Y  D  L  Q  S  D   | N  V  Y  R  A  D  L  E      p.6060

          .         .         .         .         .         .       g.173751
 TGGCTCCGAGGCATTGGCTGGATCCCACTGGATTCTGTGGACCATGTAAGGGTTACTAAG       c.18240
 W  L  R  G  I  G  W  I  P  L  D  S  V  D  H  V  R  V  T  K         p.6080

          .         .  | 116     .         .         .         .    g.173921
 AACCAGGAAATGATGAGTCAG | ATCAAATATAAGAAAAATGCCCTTGAAAACTATCCTAAC    c.18300
 N  Q  E  M  M  S  Q   | I  K  Y  K  K  N  A  L  E  N  Y  P  N      p.6100

          .         .         .         .         .         .       g.173981
 TTTAGAAGTGTGGTGGATCCTCCAGAGATTGTTTTAGCCAAGATTAATTCTGTCAATCAA       c.18360
 F  R  S  V  V  D  P  P  E  I  V  L  A  K  I  N  S  V  N  Q         p.6120

        | 117.         .         .         .         .         .    g.174393
 AGTGAT | GTAAAATATAAAGAAACATTTAATAAAGCAAAGGGCAAATATACGTTTTCACCA    c.18420
 S  D   | V  K  Y  K  E  T  F  N  K  A  K  G  K  Y  T  F  S  P      p.6140

          .         .         .         .         .  | 118     .    g.175566
 GATACACCACATATCTCCCACTCCAAAGACATGGGAAAACTCTACAGTACT | ATACTGTAT    c.18480
 D  T  P  H  I  S  H  S  K  D  M  G  K  L  Y  S  T   | I  L  Y      p.6160

          .         .         .         .         .         .       g.175626
 AAAGGGGCGTGGGAGGGCACCAAGGCCTATGGCTACACCCTGGATGAGCGCTACATTCCC       c.18540
 K  G  A  W  E  G  T  K  A  Y  G  Y  T  L  D  E  R  Y  I  P         p.6180

          .         .         .          | 119       .         .    g.175789
 ATTGTTGGAGCCAAGCATGCTGATCTGGTGAACAGTGAG | CTTAAATACAAAGAGACATAT    c.18600
 I  V  G  A  K  H  A  D  L  V  N  S  E   | L  K  Y  K  E  T  Y      p.6200

          .         .         .         .         .         .       g.175849
 GAGAAGCAGAAAGGTCACTACCTGGCTGGAAAAGTGATCGGTGAATTCCCTGGTGTGGTT       c.18660
 E  K  Q  K  G  H  Y  L  A  G  K  V  I  G  E  F  P  G  V  V         p.6220

          .         .         .    | 120   .         .         .    g.176706
 CACTGTCTGGATTTCCAAAAGATGAGGAGTGCG | TTGAACTACAGAAAACATTATGAGGAT    c.18720
 H  C  L  D  F  Q  K  M  R  S  A   | L  N  Y  R  K  H  Y  E  D      p.6240

          .         .         .         .         .         .       g.176766
 ACCAAAGCAAATGTTCATATCCCCAATGACATGATGAATCACGTGCTGGCTAAAAGGTGC       c.18780
 T  K  A  N  V  H  I  P  N  D  M  M  N  H  V  L  A  K  R  C         p.6260

          .         .         .         .         .         .       g.176826
 CAGTACATCCTCAGTGACCTGGAGTATCGACACTATTTCCACCAGTGGACGTCTCTTCTG       c.18840
 Q  Y  I  L  S  D  L  E  Y  R  H  Y  F  H  Q  W  T  S  L  L         p.6280

          .         .         .         .         .  | 121     .    g.177282
 GAAGAACCCAATGTTATACGCGTCCGAAACGCCCAGGAGATCTTGAGTGAT | AATGTGTAT    c.18900
 E  E  P  N  V  I  R  V  R  N  A  Q  E  I  L  S  D   | N  V  Y      p.6300

          .         .         .         .         .         .       g.177342
 AAAGATGACCTGAATTGGTTGAAAGGCATTGGTTGCTACGTTTGGGATACACCCCAAATC       c.18960
 K  D  D  L  N  W  L  K  G  I  G  C  Y  V  W  D  T  P  Q  I         p.6320

          .         .         .       | 122.         .         .    g.178199
 CTCCATGCCAAGAAATCATACGACCTTCAGAGTCAG | CTACAATATACAGCAGCAGGTAAA    c.19020
 L  H  A  K  K  S  Y  D  L  Q  S  Q   | L  Q  Y  T  A  A  G  K      p.6340

          .         .         .         .         .         .       g.178259
 GAAAATCTACAAAACTATAATCTGGTCACAGACACGCCCCTCTATGTGACTGCTGTTCAG       c.19080
 E  N  L  Q  N  Y  N  L  V  T  D  T  P  L  Y  V  T  A  V  Q         p.6360

          .         .  | 123     .         .         .         .    g.178418
 AGTGGCATTAATGCCAGTGAG | GTAAAATATAAAGAAAATTATCATCAGATTAAGGACAAA    c.19140
 S  G  I  N  A  S  E   | V  K  Y  K  E  N  Y  H  Q  I  K  D  K      p.6380

          .         .         .         .         .         .       g.178478
 TACACAACAGTTCTAGAAACAGTGGATTATGACAGAACCAGAAACCTGAAGAATCTTTAC       c.19200
 Y  T  T  V  L  E  T  V  D  Y  D  R  T  R  N  L  K  N  L  Y         p.6400

        | 124.         .         .         .         .         .    g.178842
 AGCAGT | AACCTGTACAAGGAGGCCTGGGATAGAGTGAAAGCCACCAGCTACATCCTGCCT    c.19260
 S  S   | N  L  Y  K  E  A  W  D  R  V  K  A  T  S  Y  I  L  P      p.6420

          .         .         .         .         .     | 125  .    g.184449
 TCCAGCACCTTGTCCCTGACACACGCCAAGAACCAGAAGCATCTGGCCAGCCAT | ATCAAA    c.19320
 S  S  T  L  S  L  T  H  A  K  N  Q  K  H  L  A  S  H   | I  K      p.6440

          .         .         .         .         .         .       g.184509
 TATCGGGAAGAATATGAAAAGTTCAAAGCTCTTTATACGTTACCAAGAAGTGTTGACGAT       c.19380
 Y  R  E  E  Y  E  K  F  K  A  L  Y  T  L  P  R  S  V  D  D         p.6460

          .         .         .         .         | 126        .    g.185474
 GATCCGAACACAGCACGGTGCCTCCGAGTTGGCAAGCTTAACATCGAT | CGCCTGTACAGA    c.19440
 D  P  N  T  A  R  C  L  R  V  G  K  L  N  I  D   | R  L  Y  R      p.6480

          .         .         .         .         .         .       g.185534
 TCAGTTTATGAAAAGAACAAGATGAAAATCCACATCGTGCCCGACATGGTAGAGATGGTT       c.19500
 S  V  Y  E  K  N  K  M  K  I  H  I  V  P  D  M  V  E  M  V         p.6500

          .         .         .         .         .         .       g.185594
 ACTGCCAAGGATTCCCAGAAGAAAGTCAGTGAGATTGATTACCGCCTGCGCCTCCACGAA       c.19560
 T  A  K  D  S  Q  K  K  V  S  E  I  D  Y  R  L  R  L  H  E         p.6520

          .         .         .         .         .         .       g.185654
 TGGATTTGCCACCCCGACTTGCAAGTCAATGATCACGTCAGGAAAGTCACAGATCAGATC       c.19620
 W  I  C  H  P  D  L  Q  V  N  D  H  V  R  K  V  T  D  Q  I         p.6540

        | 127.         .         .         .         .         .    g.186039
 AGCGAT | ATTGTATACAAGGATGACCTCAACTGGCTGAAAGGCATTGGTTGCTACGTCTGG    c.19680
 S  D   | I  V  Y  K  D  D  L  N  W  L  K  G  I  G  C  Y  V  W      p.6560

          .         .         .         .         .  | 128     .    g.186720
 GACACTCCTGAAATCCTCCATGCCAAGCATGCTTATGATCTACGTGATGAT | ATCAAGTAT    c.19740
 D  T  P  E  I  L  H  A  K  H  A  Y  D  L  R  D  D   | I  K  Y      p.6580

          .         .         .         .         .         .       g.186780
 AAAGCTCACATGTTGAAAACAAGGAATGACTACAAGCTTGTCACAGATACACCAGTCTAC       c.19800
 K  A  H  M  L  K  T  R  N  D  Y  K  L  V  T  D  T  P  V  Y         p.6600

          .         .         .       | 129.         .         .    g.187666
 GTGCAGGCTGTCAAAAGTGGGAAACAGCTAAGTGAC | GCTGTCTACCACTATGACTATGTG    c.19860
 V  Q  A  V  K  S  G  K  Q  L  S  D   | A  V  Y  H  Y  D  Y  V      p.6620

          .         .         .         .         .         .       g.187726
 CACAGTGTCAGAGGCAAAGTGGCTCCAACTACCAAAACCGTGGATCTGGACCGGGCCCTT       c.19920
 H  S  V  R  G  K  V  A  P  T  T  K  T  V  D  L  D  R  A  L         p.6640

          .         .     | 130  .         .         .         .    g.189783
 CATGCATACAAGCTCCAGAGTTCG | AATCTATACAAAACCAGCCTGCGCACCCTGCCCACT    c.19980
 H  A  Y  K  L  Q  S  S   | N  L  Y  K  T  S  L  R  T  L  P  T      p.6660

          .         .         .         .         .         .       g.189843
 GGATATAGACTTCCAGGTGACACTCCTCACTTCAAACACATCAAGGACACCCGTTACATG       c.20040
 G  Y  R  L  P  G  D  T  P  H  F  K  H  I  K  D  T  R  Y  M         p.6680

           | 131       .         .         .         .         .    g.191123
 AGCAGTTAT | TTCAAGTACAAAGAAGCCTATGAACACACCAAGGCATATGGGTATACACTT    c.20100
 S  S  Y   | F  K  Y  K  E  A  Y  E  H  T  K  A  Y  G  Y  T  L      p.6700

          .         .         .         .         .        | 132    g.191752
 GGCCCCAAAGATGTTCCATTTGTCCACGTCCGGAGAGTCAACAATGTTACCAGCGAG | AGA    c.20160
 G  P  K  D  V  P  F  V  H  V  R  R  V  N  N  V  T  S  E   | R      p.6720

          .         .         .         .         .         .       g.191812
 CTGTATCGGGAATTGTACCACAAACTGAAAGACAAGATCCATACAACTCCCGATACCCCT       c.20220
 L  Y  R  E  L  Y  H  K  L  K  D  K  I  H  T  T  P  D  T  P         p.6740

          .         .         .         .   | 133    .         .    g.191972
 GAGATCCGCCAAGTCAAGAAGACACAAGAGGCTGTCAGTGAG | TTGATCTACAAATCAGAC    c.20280
 E  I  R  Q  V  K  K  T  Q  E  A  V  S  E   | L  I  Y  K  S  D      p.6760

          .         .         .         .         .         .       g.192032
 TTCTTCAAGATGCAGGGCCACATGATCTCTCTGCCATACACACCCCAAGTGATCCATTGC       c.20340
 F  F  K  M  Q  G  H  M  I  S  L  P  Y  T  P  Q  V  I  H  C         p.6780

          .         .        | 134         .         .         .    g.193077
 CGCTATGTGGGAGACATCACCAGTGAT | ATTAAATACAAAGAGGACTTGCAGGTCCTGAAG    c.20400
 R  Y  V  G  D  I  T  S  D   | I  K  Y  K  E  D  L  Q  V  L  K      p.6800

          .         .         .         .         .         .       g.193137
 GGATTTGGCTGCTTCCTGTATGACACTCCTGACATGGTCCGCTCCCGGCACCTGCGGAAG       c.20460
 G  F  G  C  F  L  Y  D  T  P  D  M  V  R  S  R  H  L  R  K         p.6820

        | 135.         .         .         .         .         .    g.193543
 CTCTGG | TCTAATTACCTATACACTGATAAGGCAAGGAAGATGCGAGACAAATACAAAGTG    c.20520
 L  W   | S  N  Y  L  Y  T  D  K  A  R  K  M  R  D  K  Y  K  V      p.6840

          .         .         .         .         .        | 136    g.197939
 GTGCTTGACACTCCAGAATACAGAAAAGTGCAAGAACTGAAGACACATCTGAGTGAG | CTG    c.20580
 V  L  D  T  P  E  Y  R  K  V  Q  E  L  K  T  H  L  S  E   | L      p.6860

          .         .         .         .         .         .       g.197999
 GTCTACAGAGCTGCAGGCAAGAAGCAGAAGTCAATCTTTACTTCAGTTCCTGATACTCCT       c.20640
 V  Y  R  A  A  G  K  K  Q  K  S  I  F  T  S  V  P  D  T  P         p.6880

          .         .         .         .   | 137    .         .    g.198704
 GATCTTTTAAGAGCCAAGCGAGGGCAGAAGCTTCAGAGTCAG | TATCTGTATGTTGAACTT    c.20700
 D  L  L  R  A  K  R  G  Q  K  L  Q  S  Q   | Y  L  Y  V  E  L      p.6900

          .         .         .         .         .         .       g.198764
 GCCACCAAAGAGAGACCCCATCATCACGCTGGAAACCAGACCACAGCCTTGAAGCATGCT       c.20760
 A  T  K  E  R  P  H  H  H  A  G  N  Q  T  T  A  L  K  H  A         p.6920

          .         .        | 138         .         .         .    g.199072
 AAAGACGTGAAGGACATGGTCAGTGAG | AAAAAGTACAAGATTCAATATGAAAAGATGAAA    c.20820
 K  D  V  K  D  M  V  S  E   | K  K  Y  K  I  Q  Y  E  K  M  K      p.6940

          .         .         .         .         .         .       g.199132
 GACAAGTACACTCCGGTTCCAGATACGCCAATCCTCATCAGAGCCAAGAGGGCTTACTGG       c.20880
 D  K  Y  T  P  V  P  D  T  P  I  L  I  R  A  K  R  A  Y  W         p.6960

          .   | 139    .         .         .         .         .    g.201291
 AATGCCAGTGAT | CTACGCTACAAAGAAACATTTCAAAAGACCAAAGGGAAATACCACACG    c.20940
 N  A  S  D   | L  R  Y  K  E  T  F  Q  K  T  K  G  K  Y  H  T      p.6980

          .         .         .         .         .        | 140    g.201514
 GTGAAAGATGCCCTAGACATTGTCTATCATCGCAAAGTCACAGATGACATCAGTAAA | ATA    c.21000
 V  K  D  A  L  D  I  V  Y  H  R  K  V  T  D  D  I  S  K   | I      p.7000

          .         .         .         .         .         .       g.201574
 AAATACAAGGAGAACTACATGAGCCAGTTGGGTATCTGGAGGTCCATTCCTGATCGTCCA       c.21060
 K  Y  K  E  N  Y  M  S  Q  L  G  I  W  R  S  I  P  D  R  P         p.7020

          .         .         .         .   | 141    .         .    g.202269
 GAGCATTTCCACCACCGAGCAGTCACTGACACAGTCAGTGAT | GTAAAATATAAAGAAGAC    c.21120
 E  H  F  H  H  R  A  V  T  D  T  V  S  D   | V  K  Y  K  E  D      p.7040

          .         .         .         .         .         .       g.202329
 TTGACTTGGCTTAAAGGCATTGGTTGCTATGCCTATGATACCCCTGATTTCACTCTGGCT       c.21180
 L  T  W  L  K  G  I  G  C  Y  A  Y  D  T  P  D  F  T  L  A         p.7060

          .         .        | 142         .         .         .    g.203725
 GAAAAGAACAAGACTCTCTACAGCAAG | TATAAGTATAAAGAAGTATTTGAAAGGACAAAG    c.21240
 E  K  N  K  T  L  Y  S  K   | Y  K  Y  K  E  V  F  E  R  T  K      p.7080

          .         .         .         .         .         .       g.203785
 TCAGATTTCAAGTATGTTGCCGACTCTCCGATCAATAGGCATTTCAAGTATGCAACTCAA       c.21300
 S  D  F  K  Y  V  A  D  S  P  I  N  R  H  F  K  Y  A  T  Q         p.7100

          .   | 143    .         .         .         .         .    g.205216
 TTGATGAATGAG | AAAAAATACAGAGCTGATTATGAGCAGCGGAAAGATAAATACCACCTG    c.21360
 L  M  N  E   | K  K  Y  R  A  D  Y  E  Q  R  K  D  K  Y  H  L      p.7120
              ^  alternative splicing; exon 143 or exon 144 is present

          .         .         .         .         .        | 144    g.205944
 GTAGTCGATGAGCCTAGACATCTGCTGGCTAAGACCGCAGGCGACCAGATCAGTCAG | AGA    c.21420
 V  V  D  E  P  R  H  L  L  A  K  T  A  G  D  Q  I  S  Q   | R      p.7140

          .         .         .         .         .         .       g.206004
 AAATATAAATCTAGTGCCAAGATGTTTCTGCAACATGGATGTAATGAAATTCTGCGTCCA       c.21480
 K  Y  K  S  S  A  K  M  F  L  Q  H  G  C  N  E  I  L  R  P         p.7160

          .         .         .         .   | 145    .         .    g.207609
 GATATGTTGACTGCTCTCTACAATTCGCATATGTGGAGCCAG | ATCAAATACAGGAAAAAC    c.21540
 D  M  L  T  A  L  Y  N  S  H  M  W  S  Q   | I  K  Y  R  K  N      p.7180

          .         .         .         .         .         .       g.207669
 TATGAAAAATCAAAGGACAAATTTACCTCAATTGTGGATACTCCAGAACACCTGCGTACT       c.21600
 Y  E  K  S  K  D  K  F  T  S  I  V  D  T  P  E  H  L  R  T         p.7200

          .         .        | 146         .         .         .    g.208419
 ACAAAAGTCAACAAACAAATCAGCGAT | ATCCTTTATAAATTGGAATACAACAAGGCCAAA    c.21660
 T  K  V  N  K  Q  I  S  D   | I  L  Y  K  L  E  Y  N  K  A  K      p.7220

          .         .         .         .         .         .       g.208479
 CCCAGAGGCTACACCACAATCCACGACACACCCATGTTGCTGCATGTCCGCAAGGTTAAA       c.21720
 P  R  G  Y  T  T  I  H  D  T  P  M  L  L  H  V  R  K  V  K         p.7240

          .      | 147 .         .         .         .         .    g.210218
 GATGAAGTCAGTGAT | CTGAAATACAAAGAAGTATACCAAAGAAATAAATCCAACTGCACC    c.21780
 D  E  V  S  D   | L  K  Y  K  E  V  Y  Q  R  N  K  S  N  C  T      p.7260

          .         .         .         .         .         .       g.210278
 ATTGAGCCAGATGCTGTTCATATCAAAGCAGCCAAGGACGCCTACAAAGTCAACACCAAT       c.21840
 I  E  P  D  A  V  H  I  K  A  A  K  D  A  Y  K  V  N  T  N         p.7280

  | 148      .         .         .         .         .         .    g.211962
  | CTGGACTATAAGAAACAGTACGAAGCCAACAAAGCCCACTGGAAGTGGACTCCTGACCGA    c.21900
  | L  D  Y  K  K  Q  Y  E  A  N  K  A  H  W  K  W  T  P  D  R      p.7300

          .         .         .         .      | 149 .         .    g.212480
 CCGGACTTCCTCCAGGCTGCCAAGTCATCCCTGCAGCAAAGCGAT | TTTGAATATAAGCTG    c.21960
 P  D  F  L  Q  A  A  K  S  S  L  Q  Q  S  D   | F  E  Y  K  L      p.7320

          .         .         .         .         .         .       g.212540
 GACCGGGAGTTCCTCAAGGGTTGCAAGCTTTCTGTCACTGATGACAAAAACACGGTGCTC       c.22020
 D  R  E  F  L  K  G  C  K  L  S  V  T  D  D  K  N  T  V  L         p.7340

          .         .         . | 150      .         .         .    g.213255
 GCCCTCAGGAATACTTTAATAGAAAGTGAT | CTGAAATACAAAGAGAAACATGTCAAGGAA    c.22080
 A  L  R  N  T  L  I  E  S  D   | L  K  Y  K  E  K  H  V  K  E      p.7360

          .         .         .         .         .         .       g.213315
 AGAGGAACCTGCCATGCCGTACCTGACACGCCTCAGATCCTGCTGGCGAAGACTGTCAGC       c.22140
 R  G  T  C  H  A  V  P  D  T  P  Q  I  L  L  A  K  T  V  S         p.7380

          .      | 151 .         .         .         .         .    g.213464
 AACCTGGTGTCTGAG | AACAAGTACAAGGACCATGTCAAGAAGCACTTGGCACAGGGCTCA    c.22200
 N  L  V  S  E   | N  K  Y  K  D  H  V  K  K  H  L  A  Q  G  S      p.7400

          .         .         .         .         .         .       g.213524
 TACACAACACTACCAGAGACCCGGGACACTGTTCACGTCAAGGAAGTGACCAAGCATGTC       c.22260
 Y  T  T  L  P  E  T  R  D  T  V  H  V  K  E  V  T  K  H  V         p.7420

        | 152.         .         .         .         .         .    g.214268
 AGTGAT | ACAAATTACAAAAAGAAGTTTGTCAAGGAGAAAGGAAAATCCAACTACTCCATC    c.22320
 S  D   | T  N  Y  K  K  K  F  V  K  E  K  G  K  S  N  Y  S  I      p.7440

          .         .         .         .         .        | 153    g.214874
 ATGCTGGAGCCACCAGAGGTGAAACATGCTATGGAAGTGGCCAAGAAGCAAAGTGAT | GTC    c.22380
 M  L  E  P  P  E  V  K  H  A  M  E  V  A  K  K  Q  S  D   | V      p.7460

          .         .         .         .         .         .       g.214934
 GCTTACAGAAAAGATGCCAAAGAGAACCTGCATTACACCACAGTGGCTGATCGACCAGAC       c.22440
 A  Y  R  K  D  A  K  E  N  L  H  Y  T  T  V  A  D  R  P  D         p.7480

          .         .         .          | 154       .         .    g.215093
 ATCAAGAAGGCCACACAGGCAGCCAAACAGGCCAGTGAG | GTGGAGTACAGAGCCAAGCAC    c.22500
 I  K  K  A  T  Q  A  A  K  Q  A  S  E   | V  E  Y  R  A  K  H      p.7500

          .         .         .         .         .         .       g.215153
 CGCAAGGAAGGCAGCCATGGCTTAAGCATGCTCGGTCGCCCAGACATAGAAATGGCCAAG       c.22560
 R  K  E  G  S  H  G  L  S  M  L  G  R  P  D  I  E  M  A  K         p.7520

          .         .     | 155  .         .         .         .    g.219755
 AAGGCAGCCAAGCTGAGCAGCCAG | GTTAAATACCGAGAAAATTTCGATAAAGAAAAGGGC    c.22620
 K  A  A  K  L  S  S  Q   | V  K  Y  R  E  N  F  D  K  E  K  G      p.7540

          .         .         .         .         .         .       g.219815
 AAGACACCAAAATACAATCCAAAAGACAGCCAGCTCTACAAAGTCATGAAAGATGCTAAT       c.22680
 K  T  P  K  Y  N  P  K  D  S  Q  L  Y  K  V  M  K  D  A  N         p.7560

          .      | 156 .         .         .         .         .    g.220463
 AATCTTGCAAGTGAG | GTTAAATACAAGGCTGACCTGAAGAAACTTCACAAACCCGTGACT    c.22740
 N  L  A  S  E   | V  K  Y  K  A  D  L  K  K  L  H  K  P  V  T      p.7580

          .         .         .         .         .         .       g.220523
 GACATGAAGGAGTCTCTGATCATGAATCATGTCCTGAATACAAGCCAACTTGCCAGTTCT       c.22800
 D  M  K  E  S  L  I  M  N  H  V  L  N  T  S  Q  L  A  S  S         p.7600

  | 157      .         .         .         .         .         .    g.221125
  | TACCAGTACAAGAAGAAGTATGAGAAGAGTAAAGGCCACTACCACACCATACCCGATAAT    c.22860
  | Y  Q  Y  K  K  K  Y  E  K  S  K  G  H  Y  H  T  I  P  D  N      p.7620

          .         .         .         .      | 158 .         .    g.222939
 CTGGAGCAGCTTCACCTAAAAGAGGCCACAGAATTACAGAGTATA | GTGAAATACAAAGAA    c.22920
 L  E  Q  L  H  L  K  E  A  T  E  L  Q  S  I   | V  K  Y  K  E      p.7640

          .         .         .         .         .         .       g.222999
 AAGTATGAAAAGGAACGAGGAAAACCCATGCTGGACTTTGAAACACCAACGTACATCACT       c.22980
 K  Y  E  K  E  R  G  K  P  M  L  D  F  E  T  P  T  Y  I  T         p.7660

          .         .         . | 159      .         .         .    g.224589
 GCCAAAGAGTCTCAGCAGATGCAGAGTGGG | AAAGAATATAGGAAAGATTATGAAGAGTCC    c.23040
 A  K  E  S  Q  Q  M  Q  S  G   | K  E  Y  R  K  D  Y  E  E  S      p.7680

          .         .         .         .         .         .       g.224649
 ATTAAAGGCAGAAACCTGACTGGCCTGGAGGTCACGCCAGCTTTGTTACATGTCAAATAT       c.23100
 I  K  G  R  N  L  T  G  L  E  V  T  P  A  L  L  H  V  K  Y         p.7700

          .         .  | 160     .         .         .         .    g.225098
 GCAACTAAAATAGCAAGCGAG | AAAGAGTACAGGAAAGATCTAGAGGAAAGCATCCGTGGG    c.23160
 A  T  K  I  A  S  E   | K  E  Y  R  K  D  L  E  E  S  I  R  G      p.7720

          .         .         .         .         .         .       g.225158
 AAGGGCCTCACTGAAATGGAAGATACACCTGACATGCTAAGAGCAAAGAATGCCACTCAA       c.23220
 K  G  L  T  E  M  E  D  T  P  D  M  L  R  A  K  N  A  T  Q         p.7740

          .   | 161    .         .         .         .         .    g.225842
 ATCCTCAATGAG | AAAGAATATAAGCGAGACCTGGAACTGGAAGTCAAAGGAAGAGGCCTG    c.23280
 I  L  N  E   | K  E  Y  K  R  D  L  E  L  E  V  K  G  R  G  L      p.7760

          .         .         .         .         .         .       g.225902
 AATGCCATGGCCAATGAAACTCCGGATTTTATGAGGGCCAGGAATGCTACTGATATTGCC       c.23340
 N  A  M  A  N  E  T  P  D  F  M  R  A  R  N  A  T  D  I  A         p.7780

        | 162.         .         .         .         .         .    g.226704
 AGTCAG | ATTAAGTATAAGCAATCAGCAGAAATGGAGAAAGCCAATTTCACTTCTGTGGTT    c.23400
 S  Q   | I  K  Y  K  Q  S  A  E  M  E  K  A  N  F  T  S  V  V      p.7800

          .         .         .         .         .  | 163     .    g.231387
 GATACTCCAGAGATCATTCATGCCCAACAAGTCAAGAATCTTTCAAGCCAG | AAAAAGTAC    c.23460
 D  T  P  E  I  I  H  A  Q  Q  V  K  N  L  S  S  Q   | K  K  Y      p.7820

          .         .         .         .         .         .       g.231447
 AAGGAAGATGCTGAGAAGTCCATGTCGTATTATGAGACTGTTTTGGACACCCCAGAGATA       c.23520
 K  E  D  A  E  K  S  M  S  Y  Y  E  T  V  L  D  T  P  E  I         p.7840

          .         .         .       | 164.         .         .    g.232498
 CAGAGAGTCCGGGAGAACCAAAAGAACTTCAGCCTT | CTCCAATACCAGTGTGACCTTAAA    c.23580
 Q  R  V  R  E  N  Q  K  N  F  S  L   | L  Q  Y  Q  C  D  L  K      p.7860

          .         .         .         .         .         .       g.232558
 AACAGTAAAGGAAAAATTACAGTTGTTCAAGACACGCCAGAAATACTGCGTGTAAAAGAA       c.23640
 N  S  K  G  K  I  T  V  V  Q  D  T  P  E  I  L  R  V  K  E         p.7880

          .         .  | 165     .         .         .         .    g.233268
 AATCAGAAGAATTTCAGCTCG | GTTTTATATAAAGAGGATGTCTCACCAGGAACGGCTATC    c.23700
 N  Q  K  N  F  S  S   | V  L  Y  K  E  D  V  S  P  G  T  A  I      p.7900

          .         .         .         .         .     | 166  .    g.233923
 GGAAAGACACCTGAGATGATGAGAGTGAAACAAACACAGGACCACATTAGCTCG | GTGAAG    c.23760
 G  K  T  P  E  M  M  R  V  K  Q  T  Q  D  H  I  S  S   | V  K      p.7920

          .         .         .         .         .         .       g.233983
 TATAAGGAAGCAATAGGACAAGGAACTCCAATCCCTGACCTGCCTGAAGTGAAACGTGTG       c.23820
 Y  K  E  A  I  G  Q  G  T  P  I  P  D  L  P  E  V  K  R  V         p.7940

          .         .        | 167         .         .         .    g.236079
 AAGGAGACGCAGAAGCACATTAGCTCG | GTTATGTACAAAGAAAACTTGGGAACAGGCATT    c.23880
 K  E  T  Q  K  H  I  S  S   | V  M  Y  K  E  N  L  G  T  G  I      p.7960

          .         .         .         .         .         .       g.236139
 CCAACCACTGTGACTCCAGAGATTGAGAGAGTCAAACGCAATCAAGAGAACTTTAGCTCG       c.23940
 P  T  T  V  T  P  E  I  E  R  V  K  R  N  Q  E  N  F  S  S         p.7980

  | 168      .         .         .         .         .         .    g.236662
  | GTTTTGTACAAAGAAAATTTGGGGAAAGGAATCCCAACACCTATCACTCCAGAGATGGAG    c.24000
  | V  L  Y  K  E  N  L  G  K  G  I  P  T  P  I  T  P  E  M  E      p.8000

          .         .         .    | 169   .         .         .    g.238031
 AGAGTCAAACGCAATCAAGAGAACTTTAGCTCG | ATATTGTACAAAGAGAACTTGAGCAAG    c.24060
 R  V  K  R  N  Q  E  N  F  S  S   | I  L  Y  K  E  N  L  S  K      p.8020

          .         .         .         .         .         .       g.238091
 GGGACTCCCCTACCTGTCACTCCTGAGATGGAGCGAGTCAAACTCAATCAAGAAAACTTT       c.24120
 G  T  P  L  P  V  T  P  E  M  E  R  V  K  L  N  Q  E  N  F         p.8040

        | 170.         .         .         .         .         .    g.240151
 AGCTCG | GTGTTGTATAAAGAAAACGTTGGAAAAGGGATTCCAATCCCCATCACTCCAGAG    c.24180
 S  S   | V  L  Y  K  E  N  V  G  K  G  I  P  I  P  I  T  P  E      p.8060

          .         .         .          | 171       .         .    g.241156
 ATGGAGAGAGTCAAACACAATCAAGAAAACTTTAGTTCG | GTGCTATACAAAGAAAACCTG    c.24240
 M  E  R  V  K  H  N  Q  E  N  F  S  S   | V  L  Y  K  E  N  L      p.8080

          .         .         .         .         .         .       g.241216
 GGGACAGGAATTCCAATCCCCATCACTCCTGAGATGCAGAGAGTCAAACACAATCAAGAA       c.24300
 G  T  G  I  P  I  P  I  T  P  E  M  Q  R  V  K  H  N  Q  E         p.8100

          .   | 172    .         .         .         .         .    g.241817
 AACCTTAGCTCG | GTGTTATACAAAGAAAACATGGGCAAGGGAACCCCTTTACCTGTCACT    c.24360
 N  L  S  S   | V  L  Y  K  E  N  M  G  K  G  T  P  L  P  V  T      p.8120

          .         .         .         .      | 173 .         .    g.242469
 CCCGAGATGGAAAGAGTCAAACACAATCAAGAAAATATTAGCTCG | GTGTTATACAAAGAA    c.24420
 P  E  M  E  R  V  K  H  N  Q  E  N  I  S  S   | V  L  Y  K  E      p.8140

          .         .         .         .         .         .       g.242529
 AACATGGGCAAGGGAACCCCTCTACCTGTCACTCCTGAGATGGAGAGAGTCAAACACAAT       c.24480
 N  M  G  K  G  T  P  L  P  V  T  P  E  M  E  R  V  K  H  N         p.8160

          .         | 174        .         .         .         .    g.243161
 CAAGAAAATATTAGCTCG | GTGTTATACAAAGAAAACATGGGCAAGGGAACTCCTTTAGCT    c.24540
 Q  E  N  I  S  S   | V  L  Y  K  E  N  M  G  K  G  T  P  L  A      p.8180

          .         .         .         .         .  | 175     .    g.245243
 GTCACTCCCGAGATGGAGCGAGTCAAACACAATCAAGAAAATATTAGCTCG | GTTTTGTAC    c.24600
 V  T  P  E  M  E  R  V  K  H  N  Q  E  N  I  S  S   | V  L  Y      p.8200

          .         .         .         .         .         .       g.245303
 AAAGAAAATGTGGGGAAAGCCACCGCAACCCCTGTCACTCCTGAGATGCAGAGAGTCAAA       c.24660
 K  E  N  V  G  K  A  T  A  T  P  V  T  P  E  M  Q  R  V  K         p.8220

          .         .     | 176  .         .         .         .    g.245656
 CGCAATCAAGAAAACATTAGCTCG | GTGTTATACAAAGAGAACCTGGGGAAAGCAACCCCC    c.24720
 R  N  Q  E  N  I  S  S   | V  L  Y  K  E  N  L  G  K  A  T  P      p.8240

          .         .         .         .         .        | 177    g.246045
 ACACCCTTTACTCCTGAGATGGAAAGAGTGAAACGCAATCAAGAAAACTTTAGCTCG | GTA    c.24780
 T  P  F  T  P  E  M  E  R  V  K  R  N  Q  E  N  F  S  S   | V      p.8260

          .         .         .         .         .         .       g.246105
 TTGTACAAAGAGAACATGAGAAAAGCAACTCCGACACCTGTTACTCCAGAGATGGAGAGA       c.24840
 L  Y  K  E  N  M  R  K  A  T  P  T  P  V  T  P  E  M  E  R         p.8280

          .         .         . | 178      .         .         .    g.247023
 GCTAAGCGCAACCAAGAAAACATTAGCTCG | GTTCTTTATTCTGATAGTTTCCGGAAACAA    c.24900
 A  K  R  N  Q  E  N  I  S  S   | V  L  Y  S  D  S  F  R  K  Q      p.8300

          .         .         .         .         .         .       g.247083
 ATACAAGGCAAAGCTGCCTATGTATTGGATACCCCCGAGATGAGACGGGTGAGGGAGACC       c.24960
 I  Q  G  K  A  A  Y  V  L  D  T  P  E  M  R  R  V  R  E  T         p.8320

          .         | 179        .         .         .         .    g.247248
 CAACGGCACATCTCAACG | GTGAAATATCATGAAGACTTTGAGAAACACAAGGGTTGCTTC    c.25020
 Q  R  H  I  S  T   | V  K  Y  H  E  D  F  E  K  H  K  G  C  F      p.8340

          .         .         .         .         .         .       g.247308
 ACACCAGTGGTGACAGATCCTATCACTGAACGAGTAAAGAAGAACATGCAGGACTTCAGT       c.25080
 T  P  V  V  T  D  P  I  T  E  R  V  K  K  N  M  Q  D  F  S         p.8360

          .         .         .         .         .         .       g.247368
 GACATTAACTACCGAGGTATTCAGAGGAAAGTGGTAGAAATGGAACAAAAACGGAATGAC       c.25140
 D  I  N  Y  R  G  I  Q  R  K  V  V  E  M  E  Q  K  R  N  D         p.8380

          .         .   | 180    .         .         .         .    g.247750
 CAAGATCAGGAGACTATTACAG | GTTTACGTGTCTGGCGTACTAATCCTGGTTCGGTTTTT    c.25200
 Q  D  Q  E  T  I  T  G |   L  R  V  W  R  T  N  P  G  S  V  F      p.8400

          .         .         .         .         .      | 181 .    g.248974
 GACTATGATCCAGCAGAAGACAACATCCAGTCCCGAAGCTTACACATGATTAATG | TCCAA    c.25260
 D  Y  D  P  A  E  D  N  I  Q  S  R  S  L  H  M  I  N  V |   Q      p.8420

          .         .         .         .         .         .       g.249034
 GCTCAGCGCCGGAGCCGGGAGCAGTCACGATCTGCCAGTGCACTAAGCATCAGTGGGGGT       c.25320
 A  Q  R  R  S  R  E  Q  S  R  S  A  S  A  L  S  I  S  G  G         p.8440

          .         .         .         .         .         .       g.249094
 GAGGAGAAGTCTGAGCATTCAGAAGCACCAGACCACCACCTTTCGACTTACAGCGACGGG       c.25380
 E  E  K  S  E  H  S  E  A  P  D  H  H  L  S  T  Y  S  D  G         p.8460

          .         .   | 182    .         .         .         .    g.249448
 GGTGTCTTTGCAGTCTCAACAG | CTTACAAACATGCAAAAACCACAGAGCTCCCACAACAA    c.25440
 G  V  F  A  V  S  T  A |   Y  K  H  A  K  T  T  E  L  P  Q  Q      p.8480

          .         .         .         .         .         .       g.249508
 CGATCATCTTCAGTTGCTACCCAACAGACAACGGTATCTTCCATCCCATCTCATCCATCT       c.25500
 R  S  S  S  V  A  T  Q  Q  T  T  V  S  S  I  P  S  H  P  S         p.8500

           | 183       .         .         .         .         .    g.253605
 ACTGCTGGA | AAAATCTTCCGTGCCATGTATGACTATATGGCTGCTGATGCAGATGAGGTG    c.25560
 T  A  G   | K  I  F  R  A  M  Y  D  Y  M  A  A  D  A  D  E  V      p.8520

          .         .         .         .         .         .       g.253665
 TCCTTCAAGGATGGAGATGCCATCATAAATGTTCAAGCAATTGATGAAGGCTGGATGTAT       c.25620
 S  F  K  D  G  D  A  I  I  N  V  Q  A  I  D  E  G  W  M  Y         p.8540

          .         .         .         .         .         .       g.253725
 GGCACTGTGCAGAGGACTGGCAGGACCGGAATGCTCCCAGCCAACTACGTTGAAGCTATT       c.25680
 G  T  V  Q  R  T  G  R  T  G  M  L  P  A  N  Y  V  E  A  I         p.8560

                                                                    g.253728
 TAG                                                                c.25683
 X                                                                  p.8560

          .         .         .         .         .         .       g.253788
 gcatttcaaagcatcacacttgtctgcaggacttacagatcctgcagtcaatgtttcggt       c.*60

          .         .         .         .         .         .       g.253848
 ttagactctccactgttacctaagttctcaagctgcctatggtttttctgtgtcaatgtg       c.*120

          .         .         .         .         .         .       g.253908
 atttatggtagtaccatcctttctcctttgggttttaaaataagttgcagaacagacact       c.*180

          .         .         .         .         .         .       g.253968
 ttaaaagcttctgcaatattatttctgtgcctagagtctttctccattataaacatgttt       c.*240

          .         .         .         .         .         .       g.254028
 taacattatttcttttctaaaacagggattttgaatatgccaaacacattaaaggaaaaa       c.*300

          .         .         .         .         .         .       g.254088
 tagcagagatgttcaccttttccttgctgattgctaatgcttattatttctaattcagtt       c.*360

          .         .         .         .         .         .       g.254148
 ctgaagttataaacttataatcaatacaaaccagcaactaataaaacctctaattctgca       c.*420

                                                                    g.254149
 a                                                                  c.*421

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Nebulin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 29
2004-2010 Leiden University Medical Center