GDP-mannose pyrophosphorylase B (GMPPB) - coding DNA reference sequence

(used for mutation description)

(last modified July 23, 2013)


This file was created to facilitate the description of sequence variants in the GMPPB gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_033731.1, covering GMPPB transcript variant-1 (NM_013334.3.). Transcript variant-2 (NM_021971.2) misses part of exon 8, splicing this out as an intron.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                                                    g.5008
                                                     actgcccg       c.-241

 .         .         .         .         .         .                g.5068
 cgccgggtccggcctgagttcggggccagcagccgtctacccggtgtcgcgttctgtgtt       c.-181

 .         .         .         .         .         .                g.5128
 gtggcggccctggatccggcgtcagggcgaccgggcggacgaggtggagccagagtctgt       c.-121

 .         .         .         .         .         .                g.5188
 caggcgggttggtgaagggcgcggggccgggcacggcgttgggagtgcgcggcagggacc       c.-61

 .         .         .         .         .         .                g.5248
 ggccaggcgggctgcaggcacctcagagcccgggacaccccctcaacgtccgcaggcgcg       c.-1

          .         .         .         .         .         .       g.5308
 ATGAAGGCACTGATCTTAGTGGGGGGCTATGGGACGCGGCTACGGCCGCTGACGCTGAGC       c.60
 M  K  A  L  I  L  V  G  G  Y  G  T  R  L  R  P  L  T  L  S         p.20

          .         .         .         .         .         .       g.5368
 ACCCCGAAGCCACTGGTGGACTTCTGCAATAAGCCCATCTTGCTGCACCAAGTGGAGGCG       c.120
 T  P  K  P  L  V  D  F  C  N  K  P  I  L  L  H  Q  V  E  A         p.40

           | 02        .         .         .         .         .    g.5553
 CTAGCCGCG | GCAGGCGTGGACCACGTGATCCTGGCCGTGAGCTACATGTCGCAGGTGCTG    c.180
 L  A  A   | A  G  V  D  H  V  I  L  A  V  S  Y  M  S  Q  V  L      p.60

          .         .         . | 03       .         .         .    g.5702
 GAGAAGGAAATGAAGGCACAGGAGCAGAGG | CTGGGAATCCGAATCTCCATGTCCCATGAA    c.240
 E  K  E  M  K  A  Q  E  Q  R   | L  G  I  R  I  S  M  S  H  E      p.80

          .          | 04        .         .         .         .    g.5901
 GAGGAGCCTTTGGGGACAG | CTGGGCCCCTGGCGCTGGCCCGTGACCTACTCTCTGAGACT    c.300
 E  E  P  L  G  T  A |   G  P  L  A  L  A  R  D  L  L  S  E  T      p.100

          .         .         .         .         .         .       g.5961
 GCAGACCCTTTCTTCGTCCTCAACAGTGACGTGATCTGCGATTTCCCCTTCCAAGCCATG       c.360
 A  D  P  F  F  V  L  N  S  D  V  I  C  D  F  P  F  Q  A  M         p.120

          .         .         .         .   | 05     .         .    g.6238
 GTGCAGTTCCACCGGCACCATGGCCAGGAGGGCTCCATCCTG | GTGACCAAGGTGGAGGAA    c.420
 V  Q  F  H  R  H  H  G  Q  E  G  S  I  L   | V  T  K  V  E  E      p.140

          .         .         .         .         .         .       g.6298
 CCCTCCAAGTACGGTGTGGTGGTGTGTGAGGCTGACACAGGCCGCATTCACCGGTTCGTG       c.480
 P  S  K  Y  G  V  V  V  C  E  A  D  T  G  R  I  H  R  F  V         p.160

          .         .         .         .         .         .       g.6358
 GAGAAGCCACAGGTGTTTGTGTCCAATAAGATCAACGCAGGCATGTACATCCTGAGCCCT       c.540
 E  K  P  Q  V  F  V  S  N  K  I  N  A  G  M  Y  I  L  S  P         p.180

          .         .  | 06      .         .         .         .    g.6503
 GCAGTGCTGCGGCGCATCCAG | CTGCAGCCTACGTCCATTGAGAAGGAGGTCTTCCCCATT    c.600
 A  V  L  R  R  I  Q   | L  Q  P  T  S  I  E  K  E  V  F  P  I      p.200

          .         .         .         . | 07       .         .    g.6636
 ATGGCCAAGGAGGGGCAGCTATATGCCATGGAGTTACAGG | GCTTCTGGATGGACATTGGG    c.660
 M  A  K  E  G  Q  L  Y  A  M  E  L  Q  G |   F  W  M  D  I  G      p.220

          .         .         .         .         .         .       g.6696
 CAGCCCAAGGACTTCCTCACTGGCATGTGCCTCTTCCTGCAGTCACTGAGGCAGAAGCAG       c.720
 Q  P  K  D  F  L  T  G  M  C  L  F  L  Q  S  L  R  Q  K  Q         p.240

          .         .         .         .         | 08         .    g.6839
 CCTGAGCGGCTGTGCTCAGGCCCTGGCATTGTGGGCAACGTGCTGGTG | GACCCAAGTGCC    c.780
 P  E  R  L  C  S  G  P  G  I  V  G  N  V  L  V   | D  P  S  A      p.260

          .         .         .         .         .         .       g.6899
 CGCATCGGCCAGAACTGCAGCATTGGCCCCAATGTGAGCCTGGGACCTGGCGTGGTGGTC       c.840
 R  I  G  Q  N  C  S  I  G  P  N  V  S  L  G  P  G  V  V  V         p.280

          .         .         .         .         .         .       g.6959
 GAAGATGGTGTGTGTATCCGGCGGTGCACGGTGCTGCGGGATGCCCGGATCCGTTCCCAT       c.900
 E  D  G  V  C  I  R  R  C  T  V  L  R  D  A  R  I  R  S  H         p.300

          .         .         .         .         .  |         .       g.7019
 TCCTGGCTTGAGTCCTGCATTGTGGGCTGGCGCTGCCGCGTGGGTCAGTGG | GTAAGCCTG       c.960
 S  W  L  E  S  C  I  V  G  W  R  C  R  V  G  Q  W   | V  S  L         p.320
                                                     ^  differentially spliced exon

          .         .         .         .         .         .       g.7079
 TGGGCTGGGCTGGGTGGGGAGAGGGGCGGGGAGTGTGCCTGCCTCCCTGACAAGGCCTAT       c.1020
 W  A  G  L  G  G  E  R  G  G  E  C  A  C  L  P  D  K  A  Y         p.340

          .   |        .         .         .         .         .       g.7139
 CCTCTCCTGGAG | GTACGCATGGAGAACGTGACAGTGCTGGGTGAGGACGTCATAGTTAAT       c.1080
 P  L  L  E   | V  R  M  E  N  V  T  V  L  G  E  D  V  I  V  N         p.360
              ^  differentially spliced exon

          .         .         .         .         .         .       g.7199
 GATGAGCTCTACCTCAACGGAGCCAGCGTGCTGCCCCACAAGTCTATTGGCGAGTCAGTG       c.1140
 D  E  L  Y  L  N  G  A  S  V  L  P  H  K  S  I  G  E  S  V         p.380

          .         .                                               g.7223
 CCAGAGCCTCGTATCATCATGTGA                                           c.1164
 P  E  P  R  I  I  M  X                                             p.387

          .         .         .         .         .         .       g.7283
 ggggatgcagtggggctggccgagccccggttttcccatcagcaaggggagtgctggcct       c.*60

          .         .         .         .         .         .       g.7343
 gacacatcagaagaccctggacttgtcattatttgtctggggggcactgggtgaagctga       c.*120

          .         .         .         .         .         .       g.7403
 agctgttggacacctgccttctcatgtggacatcatctggcaggatccctgctgggcaca       c.*180

          .         .         .         .         .         .       g.7463
 ccccacaaaccccactccctcaagaagggccagggccagggctgtatggaataataattt       c.*240

          .         .         .                                     g.7499
 aatgctcactgtggccctgactgaaagtcaagctca                               c.*276

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The GDP-mannose pyrophosphorylase B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 35
2004-2013 Leiden University Medical Center