Fukutin-Related Protein (FKRP) - coding DNA reference sequence

(used for mutation description)

(last modified March 24, 2010)


This file was created to facilitate the description of sequence variants in the FKRP gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008898.1, covering FKRP transcript variant 1 (NM_024301.4). Transcript variant 2 (NM_001039885.2) uses an alternative splice acceptor site in exon 03b

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
           .         .         .         .        | 02.             g.6993
    gtcccggcggccattgctccaagatggcggcggcggcggcagcgg | gagcgcagctca    c.-241

 .         .         .         .         .          | 03            g.7479
 gctgggctggaactgccctcctggaactcccccagcctacaacctaggag | gtgcagggac    c.-181

 .         .         .         .         .         .                g.7539
 tgaggctcaggccaaatcgcaactcagacccagtgaacccaaggcctgaagagaatttgg       c.-121

 .         .         .         .         .         .                g.7599
 attcatttaccttgttttgtggggactggagagacaagtaaactctcagagtaactgtcc       c.-61

 .         .         . | 04       .         .         .             g.14405
 cctctgactaccatttctaag | gatgccccggaggcccagctagccccagacttcggcccc    c.-1

          .         .         .         .         .         .       g.14465
 ATGCGGCTCACCCGCTGCCAGGCTGCCCTGGCGGCCGCCATCACCCTCAACCTTCTGGTC       c.60
 M  R  L  T  R  C  Q  A  A  L  A  A  A  I  T  L  N  L  L  V         p.20

          .         .         .         .         .         .       g.14525
 CTCTTCTATGTCTCGTGGCTGCAGCACCAGCCTAGGAATTCCCGGGCCCGGGGGCCCCGT       c.120
 L  F  Y  V  S  W  L  Q  H  Q  P  R  N  S  R  A  R  G  P  R         p.40

          .         .         .         .         .         .       g.14585
 CGTGCCTCTGCTGCCGGCCCCCGTGTCACCGTCCTGGTGCGGGAGTTCGAGGCATTTGAC       c.180
 R  A  S  A  A  G  P  R  V  T  V  L  V  R  E  F  E  A  F  D         p.60

          .         .         .         .         .         .       g.14645
 AACGCGGTGCCCGAGCTGGTAGACTCCTTCCTGCAGCAAGACCCAGCCCAGCCCGTGGTG       c.240
 N  A  V  P  E  L  V  D  S  F  L  Q  Q  D  P  A  Q  P  V  V         p.80

          .         .         .         .         .         .       g.14705
 GTGGCAGCCGACACGCTCCCCTACCCGCCCCTGGCCCTGCCCCGCATCCCCAACGTGCGT       c.300
 V  A  A  D  T  L  P  Y  P  P  L  A  L  P  R  I  P  N  V  R         p.100

          .         .         .         .         .         .       g.14765
 CTGGCGCTGCTCCAGCCCGCCCTGGACCGGCCAGCCGCAGCCTCGCGCCCGGAGACCTAC       c.360
 L  A  L  L  Q  P  A  L  D  R  P  A  A  A  S  R  P  E  T  Y         p.120

          .         .         .         .         .         .       g.14825
 GTGGCCACCGAGTTTGTGGCCCTAGTACCTGATGGGGCGCGGGCTGAGGCACCTGGCCTG       c.420
 V  A  T  E  F  V  A  L  V  P  D  G  A  R  A  E  A  P  G  L         p.140

          .         .         .         .         .         .       g.14885
 CTGGAGCGCATGGTGGAGGCGCTCCGCGCAGGAAGCGCACGTCTGGTGGCCGCCCCGGTT       c.480
 L  E  R  M  V  E  A  L  R  A  G  S  A  R  L  V  A  A  P  V         p.160

          .         .         .         .         .         .       g.14945
 GCCACGGCCAACCCTGCCAGGTGCCTGGCCCTGAACGTCAGCCTGCGAGAGTGGACCGCC       c.540
 A  T  A  N  P  A  R  C  L  A  L  N  V  S  L  R  E  W  T  A         p.180

          .         .         .         .         .         .       g.15005
 CGCTATGGCGCAGCCCCCGCCGCGCCCCGCTGCGACGCCCTGGACGGAGATGCTGTGGTG       c.600
 R  Y  G  A  A  P  A  A  P  R  C  D  A  L  D  G  D  A  V  V         p.200

          .         .         .         .         .         .       g.15065
 CTCCTGCGCGCCCGCGACCTCTTCAACCTCTCGGCGCCCCTGGCCCGGCCGGTGGGCACC       c.660
 L  L  R  A  R  D  L  F  N  L  S  A  P  L  A  R  P  V  G  T         p.220

          .         .         .         .         .         .       g.15125
 AGCCTCTTTCTGCAGACCGCCCTTCGCGGCTGGGCGGTGCAGCTGCTGGACTTGACCTTC       c.720
 S  L  F  L  Q  T  A  L  R  G  W  A  V  Q  L  L  D  L  T  F         p.240

          .         .         .         .         .         .       g.15185
 GCCGCGGCGCGCCAGCCCCCGCTGGCCACGGCCCACGCGCGCTGGAAGGCTGAGCGCGAG       c.780
 A  A  A  R  Q  P  P  L  A  T  A  H  A  R  W  K  A  E  R  E         p.260

          .         .         .         .         .         .       g.15245
 GGACGCGCTCGGCGGGCGGCGCTGCTCCGCGCGCTGGGCATCCGCCTAGTGAGCTGGGAA       c.840
 G  R  A  R  R  A  A  L  L  R  A  L  G  I  R  L  V  S  W  E         p.280

          .         .         .         .         .         .       g.15305
 GGCGGGCGGCTGGAGTGGTTCGGCTGCAACAAGGAGACCACGCGCTGCTTCGGAACCGTG       c.900
 G  G  R  L  E  W  F  G  C  N  K  E  T  T  R  C  F  G  T  V         p.300

          .         .         .         .         .         .       g.15365
 GTGGGCGACACGCCCGCCTACCTCTACGAGGAGCGCTGGACGCCCCCCTGCTGCCTGCGC       c.960
 V  G  D  T  P  A  Y  L  Y  E  E  R  W  T  P  P  C  C  L  R         p.320

          .         .         .         .         .         .       g.15425
 GCGCTGCGCGAGACCGCCCGCTATGTGGTGGGCGTGCTGGAGGCTGCGGGCGTGCGCTAC       c.1020
 A  L  R  E  T  A  R  Y  V  V  G  V  L  E  A  A  G  V  R  Y         p.340

          .         .         .         .         .         .       g.15485
 TGGCTCGAGGGCGGCTCACTGCTGGGGGCCGCCCGCCACGGGGACATCATCCCATGGGAC       c.1080
 W  L  E  G  G  S  L  L  G  A  A  R  H  G  D  I  I  P  W  D         p.360

          .         .         .         .         .         .       g.15545
 TACGACGTGGACCTGGGCATCTACTTGGAGGACGTGGGCAACTGCGAGCAGCTGCGGGGG       c.1140
 Y  D  V  D  L  G  I  Y  L  E  D  V  G  N  C  E  Q  L  R  G         p.380

          .         .         .         .         .         .       g.15605
 GCAGAGGCCGGCTCGGTGGTGGATGAGCGCGGCTTCGTATGGGAGAAGGCGGTCGAGGGC       c.1200
 A  E  A  G  S  V  V  D  E  R  G  F  V  W  E  K  A  V  E  G         p.400

          .         .         .         .         .         .       g.15665
 GACTTTTTCCGCGTGCAGTACAGCGAAAGCAACCACTTGCACGTGGACCTGTGGCCCTTC       c.1260
 D  F  F  R  V  Q  Y  S  E  S  N  H  L  H  V  D  L  W  P  F         p.420

          .         .         .         .         .         .       g.15725
 TACCCCCGCAATGGCGTCATGACCAAGGACACGTGGCTGGACCACCGGCAGGATGTGGAG       c.1320
 Y  P  R  N  G  V  M  T  K  D  T  W  L  D  H  R  Q  D  V  E         p.440

          .         .         .         .         .         .       g.15785
 TTTCCCGAGCACTTCCTGCAGCCGCTGGTGCCCCTGCCCTTTGCCGGCTTCGTGGCGCAG       c.1380
 F  P  E  H  F  L  Q  P  L  V  P  L  P  F  A  G  F  V  A  Q         p.460

          .         .         .         .         .         .       g.15845
 GCGCCTAACAACTACCGCCGCTTCCTGGAGCTCAAGTTCGGGCCCGGGGTCATCGAGAAC       c.1440
 A  P  N  N  Y  R  R  F  L  E  L  K  F  G  P  G  V  I  E  N         p.480

          .         .         .         .                           g.15893
 CCCCAGTACCCCAACCCGGCACTGCTGAGTCTGACGGGAAGCGGCTGA                   c.1488
 P  Q  Y  P  N  P  A  L  L  S  L  T  G  S  G  X                     p.495

          .         .         .         .         .         .       g.15953
 agccctgataacctcgcctttgtttttcgggggtctgtctggatgtggagaagctctgtg       c.*60

          .         .         .         .         .         .       g.16013
 tgagcggtgaggggtggagggatgtcgcggagaggggaagggggaaactgaccaagaaag       c.*120

          .         .         .         .         .         .       g.16073
 aaattctaaggagagcatgagagaaggctggcattggcaggaggagagcaccaggacgag       c.*180

          .         .         .         .         .         .       g.16133
 gatgggaagcgacctccagatttatcaaatggtcatgcccactgggagccgtggatatgc       c.*240

          .         .         .         .         .         .       g.16193
 gtggggacatcctgggtcatctcagtcatggagggagacggggatgtcacgccgtcccgc       c.*300

          .         .         .         .         .         .       g.16253
 agggcccagcacagccccagacccgaaaaaagtgttctgcccaagattccgagagccctg       c.*360

          .         .         .         .         .         .       g.16313
 cgctctagggcaggggcagagttttggaaacagtgcaggctctggagccagactggcgag       c.*420

          .         .         .         .         .         .       g.16373
 attcaaatcctggctctatcgcttcggagccaggtgggcctgggggggcgtcgcagtctc       c.*480

          .         .         .         .         .         .       g.16433
 tctgtgcctcagttgcttccaggatgcgggacccttggctgcaggggttgcttccgccac       c.*540

          .         .         .         .         .         .       g.16493
 tagagggcgcgccggtcccgctcctggtggcccactgtggctgcccgggcgacagtacgc       c.*600

          .         .         .         .         .         .       g.16553
 ccagggcctgtgttccatagccatctactctcttgagcctttggacttctctccaagccc       c.*660

          .         .         .         .         .         .       g.16613
 ctgtgggaggcggacagcagtgaccacctccccttcttttggactgcgacctccttccct       c.*720

          .         .         .         .         .         .       g.16673
 cctgggagagccctgtgacctgcatgctactcttaactgttctattcaagactgaataga       c.*780

          .         .         .         .         .         .       g.16733
 agtatttcagtcttgcagaggaggaaatgctcagagctccgaggtgcggctgtggtcgag       c.*840

          .         .         .         .         .         .       g.16793
 aaccgggtgctgggccgggcgcgggggctcacgcctgtaatcccagcactttgggaggcc       c.*900

          .         .         .         .         .         .       g.16853
 gaggtgggaggatcgcttgagcccaggagtctgagaccagcctcggcaacatgccaagac       c.*960

          .         .         .         .         .         .       g.16913
 cccgtctctatttttaaaaaagaaaaagaaccgacttctgaatcgcagctccactcatga       c.*1020

          .         .         .         .         .         .       g.16973
 ctaatacctcattatttcagctgtctgcacctaattccccacttgcacggcagtgtagac       c.*1080

          .         .         .         .         .         .       g.17033
 aataaccatagctcacactcactgagcacctactgggtaccaggcaccattctcagtgtt       c.*1140

          .         .         .         .         .         .       g.17093
 tcacctggatcaactaatgcgtccctcacctcagccctctgaagtgacagctgctattat       c.*1200

          .         .         .         .         .         .       g.17153
 tttcattacacagatgaaaaagctgaggccagaatcgtgaagtcacttgctcaaggtcag       c.*1260

          .         .         .         .         .         .       g.17213
 gcagcttaggaaggggcagatcgggggcttgaacccaggtggtcaggctctggagcccac       c.*1320

          .         .         .         .         .         .       g.17273
 aattgtcttacccactatgcccctctctagtcatggtccccaagaggggcttggagaccc       c.*1380

          .         .         .         .         .         .       g.17333
 acttagcaggtgaaagcaatggcagccttccttatttgattatgcacctaagaataaatg       c.*1440

          .         .         .         .         .         .       g.17393
 gtatttgggcatgtattcccaatatgtgtatatttatttataaatatatacagatactat       c.*1500

          .         .         .         .         .         .       g.17453
 tatctgtatgttagtaataaagcttaaattattccattttaaaattatgaatatgaatag       c.*1560

          .         .         .         .         .         .       g.17513
 ggttttttttatgtttcttgcctcatcccaatgacttttgcacacccaggtgtgagcacc       c.*1620

          .                                                         g.17530
 cagcattcaagaccacg                                                  c.*1637

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fukutin-Related Protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 25
2004-2010 Leiden University Medical Center