Emery-Dreifuss muscular dystrophy (emerin) (EMD) - coding DNA reference sequence

(used for mutation description)

(last modified July 19, 2009)


This file was created to facilitate the description of sequence variants in the EMD gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008677.1, covering EMD transcript NM_000117.2.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                                                    g.9809
                                                     cacggccg       c.-241

 .         .         .         .         .         .                g.9869
 gtctgtgccggctgctcccgcggttaggtcccgccccgcgcagcgcgcgcagcctgcgga       c.-181

 .         .         .         .         .         .                g.9929
 gccagcggccgtgacgcgacaacgattcggctgtgacgcgacaacgattcggctgtgacg       c.-121

 .         .         .         .         .         .                g.9989
 cgagcgcggccgctcccgatgcgctcgtgccgcccccgccgtgctcctcggcagccgttg       c.-61

 .         .         .         .         .         .                g.10049
 ctcggccggttttggtaggcccgggccgccgccaggcctccgcctgagcccgcacccgcc       c.-1

          .         .         .         .         .         .       g.10109
 ATGGACAACTACGCAGATCTTTCGGATACCGAGCTGACCACCTTGCTGCGCCGGTACAAC       c.60
 M  D  N  Y  A  D  L  S  D  T  E  L  T  T  L  L  R  R  Y  N         p.20

          .         .   | 02     .         .         .         .    g.10292
 ATCCCGCACGGGCCTGTAGTAG | GATCAACTCGTAGGCTTTACGAGAAGAAGATCTTCGAG    c.120
 I  P  H  G  P  V  V  G |   S  T  R  R  L  Y  E  K  K  I  F  E      p.40

          .         .         .         .         .         .       g.10352
 TACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAGCTCGTCCGCCGCCTCCTCTTATAGC       c.180
 Y  E  T  Q  R  R  R  L  S  P  P  S  S  S  A  A  S  S  Y  S         p.60

         | 03.         .         .         .         .         .    g.10559
 TTCTCTG | ACTTGAATTCGACTAGAGGGGATGCAGATATGTATGATCTTCCCAAGAAAGAG    c.240
 F  S  D |   L  N  S  T  R  G  D  A  D  M  Y  D  L  P  K  K  E      p.80

          .         .      | 04  .         .         .         .    g.10833
 GACGCTTTACTCTACCAGAGCAAGG | GCTACAATGACGACTACTATGAAGAGAGCTACTTC    c.300
 D  A  L  L  Y  Q  S  K  G |   Y  N  D  D  Y  Y  E  E  S  Y  F      p.100

          .         .         .         .         .         .       g.10893
 ACCACCAGGACTTATGGGGAGCCCGAGTCTGCCGGCCCGTCCAGGGCTGTCCGCCAGTCA       c.360
 T  T  R  T  Y  G  E  P  E  S  A  G  P  S  R  A  V  R  Q  S         p.120

          .         .         .          | 05        .         .    g.11338
 GTGACTTCATTCCCAGATGCTGACGCTTTCCATCACCAG | GTGCATGATGACGATCTTTTG    c.420
 V  T  S  F  P  D  A  D  A  F  H  H  Q   | V  H  D  D  D  L  L      p.140

          .         .          | 06        .         .         .    g.11477
 TCTTCTTCTGAAGAGGAGTGCAAGGATAG | GGAACGCCCCATGTACGGCCGGGACAGTGCC    c.480
 S  S  S  E  E  E  C  K  D  R  |  E  R  P  M  Y  G  R  D  S  A      p.160

          .         .         .         .         .         .       g.11537
 TACCAGAGCATCACGCACTACCGCCCTGTTTCAGCCTCCAGGAGCTCCCTGGACCTGTCC       c.540
 Y  Q  S  I  T  H  Y  R  P  V  S  A  S  R  S  S  L  D  L  S         p.180

          .         .         .         .         .         .       g.11597
 TATTATCCTACTTCCTCCTCCACCTCTTTTATGTCCTCCTCATCATCTTCCTCTTCATGG       c.600
 Y  Y  P  T  S  S  S  T  S  F  M  S  S  S  S  S  S  S  S  W         p.200

          .         .         .         .         .         .       g.11657
 CTCACCCGCCGTGCCATCCGGCCTGAAAACCGTGCTCCTGGGGCTGGGCTGGGCCAGGAT       c.660
 L  T  R  R  A  I  R  P  E  N  R  A  P  G  A  G  L  G  Q  D         p.220

          .         .         .         .         .         .       g.11717
 CGCCAGGTCCCGCTCTGGGGCCAGCTGCTGCTTTTCCTGGTCTTTGTGATCGTCCTCTTC       c.720
 R  Q  V  P  L  W  G  Q  L  L  L  F  L  V  F  V  I  V  L  F         p.240

          .         .         .         .                           g.11762
 TTCATTTACCACTTCATGCAGGCTGAAGAAGGCAACCCCTTCTAG                      c.765
 F  I  Y  H  F  M  Q  A  E  E  G  N  P  F  X                        p.254

          .         .         .         .         .         .       g.11822
 agggagccatgagggtctgggcttcagagctaggtctttggggaagtcctggctgactgc       c.*60

          .         .         .         .         .         .       g.11882
 cttagcagtgggggtgggggtgggggcaggggcaggggctttatgtgtttttgcttgggg       c.*120

          .         .         .         .         .         .       g.11942
 ggcgctgggcctagcccagagtagtgcttgctccccctgccttgtcccaccagggaggca       c.*180

          .         .         .         .         .         .       g.12002
 gcagactcaggccctccatggtcctctttgtcattttgttgacatgcattcctccttttg       c.*240

          .         .         .         .         .         .       g.12062
 tcatcttgttggggggaggggattaaccaaaggccaccctgactttgtttttgtggacac       c.*300

          .         .                                               g.12088
 acaataaaagccccgtttatttgtaa                                         c.*326

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Emery-Dreifuss muscular dystrophy (emerin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center