Duchenne Muscular Dystrophy (DMD) - 698 nt intron 70 reference sequence

(intronic numbering for coding DNA Reference Sequence)

Contains 3'-terminal exon Dp40


3'-terminal exon Dp40
         .         .         .         .         .         .  g.2166001
gtgagtagtagcaaaagcagaacacactcttgtttgatgtatatttgaactcctctcagc  c.10223+60
 *    (end translation Dp40)

         .         .         .         .         .         .  g.2166061
tgaacaccctccttcactcccaaatgcaaacagtctcttctatttctttctttttattta  c.10223+120

         .         .         .         .         .         .  g.2166121
cattagctgaaaagagaaaaataagctgatgtccagttgccactttcccacgtcacttga  c.10223+180

         .         .         .         .         .         .  g.2166181
caatttctttttccaaaagttaaactttatctcacagggggaaaaaaaaaaaaaaaccac  c.10223+240

         .         .         .         .         .         .  g.2166241
aacacaatacagccactaattgccttacaagccttataagaaatatgggactgtttacaa  c.10223+300

         .         .         .         .           g.2166290
atgagtgattccagtatttcattttgattttcctctctcacaaatcagt  c.10223+349

--------------------- middle of intron ---------------------
         g.2166291             .         .         .         .           g.2166339
         c.10224-349  aaatgtgtgtctttttgtatctcattgtgtggtcatatctagtcacttg  c.10224-301

.         .         .         .         .         .           g.2166399
tttctactcaaaagaaaatatagtcacaggaaactacttcacagtaagtagtaatgattc  c.10224-241

.         .      \    .         .         .         .           g.2166459
tcaagatcaaagggga \ cgtcttcacctcttttcaacctgctcctcttttttgccttaact  c.10224-181
                 \ polyA-addition site Dp40

.         .         .         .         .         .           g.2166519
ctgatggcagtcacacaactgtgtgtttttcttttaattcactttacaccttggtttggc  c.10224-121

.         .         .         .         .         .           g.2166579
tattgctttccatggttcatacttaattggctggattttatttattttgacctttcagta  c.10224-61

.         .         .         .         .         .           g.2166639
aatttttttgcggctgagtttgcgtgtgtctccttcaccacctcattttttgttttgcag  c.10224-1


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center