Duchenne Muscular Dystrophy (DMD) - 26327 nt intron 29 reference sequence

(intronic numbering for coding DNA Reference Sequence)

Contains the Dp260 promoter/exon 1


         .         .         .         .         .         .  g.906429
gtatgaagataagtgaaaaatctctttaatctaatttgcattaatgtatagcagatacag  c.4071+60

         .         .         .         .         .         .  g.906489
gcctctcagataaaatgagcaatagtttaaatattagctcagctttcaggtttcagagac  c.4071+120

         .         .         .         .         .         .  g.906549
aatccaatgccagacactgggtaaattctttacatgtgtattatagcatgtgatttcaca  c.4071+180

         .         .         .         .         .         .  g.906609
aaaacattgtaagttaggattcttaaaaggcaactgagacatcccaagaaggttactctg  c.4071+240

         .         .         .         .         .         .  g.906669
accacagagttcttttccttactcaagatagaccagtatgtgtgggtatcctttctctct  c.4071+300

         .         .         .         .         .         .  g.906729
cgctgtctcattttattcctctccctccattccacacacatttgttatgtcacatgtaat  c.4071+360

         .         .         .         .         .         .  g.906789
ctgctaataatacatgcaattctgttagtaccccatattatttattcttcataaataaca  c.4071+420

         .         .         .         .         .         .  g.906849
ctacatttcttatagataaattttcatatatcacacatggtgtgatttttcaaatcaaaa  c.4071+480

         .         .         .         .         .         .  g.906909
ctaaaacaaaatagcaaatttctcctagtcagtgttttgcatactatctcctaagaatgg  c.4071+540

         .         .         .         .         .         .  g.906969
attatttgtcaagaagaaaacccattttataatgatgtttagttttatattcacttactg  c.4071+600

         .         .         .         .         .         .  g.907029
agtacatctactacatgtgagatatggttctatggtttgatgagtaggaaaaatttgcta  c.4071+660

         .         .         .         .         .         .  g.907089
accttcataacttaaaaacattggttagttaaggaagagttactgatttcctagaatgtg  c.4071+720

         .         .         .         .         .         .  g.907149
caagacataaaaacaaataatataacgtatgaagagaaaaaagagaataagggggggtag  c.4071+780

         .         .         .         .         .         .  g.907209
taactagggtagtatgcatgaaaccattgactaatgacttattgaatagtcaatgtcggg  c.4071+840

         .         .         .         .         .         .  g.907269
gaccttttgacatgcttacagattgaaaaggaacgccttgagtaggaaaacctcttctct  c.4071+900

         .         .         .         .         .         .  g.907329
atccaattctgaagagaagtatgtgagggtagggcagatatctgcaaatgtaccagcagc  c.4071+960

         .         .         .         .         .         .  g.907389
acctccagtcttgaatcctgggtggcatatccatattttatccaaatcaacataaggaat  c.4071+1020

         .         .         .         .         .         .  g.907449
tggggattggaaaaggggaattccaaacaatctctggtccttcatcattgttgcactatt  c.4071+1080

         .         .         .         .         .         .  g.907509
gctggatctgagtcaaatagatattgctatgtggcaagtaaattgaagatcatttcaatg  c.4071+1140

         .         .         .         .         .         .  g.907569
tgggttgtgatatggaattggaatgtgtttttatttctatttgaatatcagtgtcaggta  c.4071+1200

         .         .         .         .         .         .  g.907629
ggagacagcagttgcatcaaaaaattaaaagtcattgtgaaactgaccttggcttagctg  c.4071+1260

         .         .         .         .         .         .  g.907689
tgaaaagactcaaatttttttttttttaaagacagggtcttgctctgtccctgagactgg  c.4071+1320

         .         .         .         .         .         .  g.907749
agtgcagtggcatgatcgtggctcactgtagcctcgacctccctgggctcaggtgatctt  c.4071+1380

         .         .         .         .         .         .  g.907809
cccacctcagcctcctgagtagctgggactacaggtgcatgctgccactcccggttattt  c.4071+1440

         .         .         .         .         .         .  g.907869
gtgtgtgtgtgtgtggaaatgttgttttgccatgttgtccaggctggtcttgaactcccg  c.4071+1500

         .         .         .         .         .         .  g.907929
ggctcaagctatccacttgccttggcctcccaaagtgctgggagatacacctggccaaga  c.4071+1560

         .         .         .         .         .         .  g.907989
tccaacttcagtgtttgacatttttcagtactcatctattctgtccttaggaatagctta  c.4071+1620

         .         .         .         .         .         .  g.908049
ctctctaacttgatcttggtattaactctattaatgtaattatattgcaatcctttatta  c.4071+1680

         .         .         .         .         .         .  g.908109
acacaaaactacttataaccttctattttaaaggtttttggtataaaccctgacatttcc  c.4071+1740

         .         .         .         .         .         .  g.908169
cccaaagaaaaaataattcatttcagcaacataccctgattcaacacgtattatcttatt  c.4071+1800

         .         .         .         .         .         .  g.908229
ttctggactgagtttttaaagcataaacttttgaataagaaaatacttgaaacttgggct  c.4071+1860

         .         .         .         .         .         .  g.908289
agaataacaccttgtattagtagtcagggtccagacagggcacagaaaccactcagtcac  c.4071+1920

         .         .         .         .         .         .  g.908349
ttaaacagagatggtttaacacaaataagtattaactacttactggaaattaatttttaa  c.4071+1980

         .         .         .         .         .         .  g.908409
taggaaataaaagagatctctaaagaataccttaagcctgaggaatagtacacaaacaag  c.4071+2040

         .         .         .         .         .         .  g.908469
gaactaatatggaaagataggagctcaacccaaggctggattcaaacttctttagaaagt  c.4071+2100

         .         .         .         .         .         .  g.908529
gtgtgtctgcctcccatgggatgacagagaagtttccttcattgacccaatccagaacaa  c.4071+2160

         .         .         .         .         .         .  g.908589
gtctatagccagtgagctgaagctagtgtgaagagaatattggaggggaatgctgacaaa  c.4071+2220

         .         .         .         .         .         .  g.908649
attcacagggaagtagcctatggtggggaaccattgaatttgctagaaagctgtctggtg  c.4071+2280

         .         .         .         .         .         .  g.908709
tattcattggacatggtgggaaactacctgtagtggatgctactaaacttgaggaaatga  c.4071+2340

         .         .         .         .         .         .  g.908769
ggtggggctccaggaagctgcctatggatttgccacccatcctcaatttgcttattgggt  c.4071+2400

         .         .         .         .         .         .  g.908829
acccatagaacttgtcaaacacgacccatagtgttgctgaaagtcttctgggtaaagtgg  c.4071+2460

         .         .         .         .         .         .  g.908889
ggtggatgaggtgagccttactgggcattccataggccagcccagagtcacaggtttgaa  c.4071+2520

         .         .         .         .         .         .  g.908949
aaagaattaaaagcacactgggacagacaaacctctacctcccccattgtcactccagca  c.4071+2580

         .         .         .         .         .         .  g.909009
tcctttactgacagaacttaatatcatgtcagctggcaaggggagaaatgttcccgtgtc  c.4071+2640

         .         .         .         .         .         .  g.909069
aaaaacaggatcatgttgaaaggcaaaaaattgataactggcaaatccctctgtaattca  c.4071+2700

         .         .         .         .         .         .  g.909129
ctggctatgtgattttgagtaacagttttaaacttacgtttcctcatcctgtttcatagg  c.4071+2760

         .         .         .         .         .         .  g.909189
gggttttttttgtgagcaaaatataaaatacggcacttaaagtactatggttccaggaac  c.4071+2820

         .         .         .         .         .         .  g.909249
acagtacatattcaataaattattcaataaatttaatacatgatcagcctttttattttg  c.4071+2880

         .         .         .         .         .         .  g.909309
actagatgatattctagagtatcagccctcaaaaattgtgtgtgtgtgtttgtatgggtg  c.4071+2940

         .         .         .         .         .         .  g.909369
taaatatatatatatatatatatatgtaagtatatattaaaatatgtaaatatatattta  c.4071+3000

         .         .         .         .         .         .  g.909429
aaaatatgtaaatatacatatatatatatcccactgagggcagtgattggtaaataaatg  c.4071+3060

         .         .         .         .         .         .  g.909489
cagatagtgcaatatgaaatataatgaaatgcacatgcctccattagttaaataaaatgt  c.4071+3120

         .         .         .         .         .         .  g.909549
gaagacagataaaaaggatttttatcaccctctaagtcttaaaatcagaagctctccact  c.4071+3180

         .         .         .         .         .         .  g.909609
tgtacctcaatgattaagcagagtgttaaaataacaataaatctaaaataagtaaacttg  c.4071+3240

         .         .         .         .         .         .  g.909669
aaactattatcagtcctagctgtgtttatattacatatttggccagtaataacctgggag  c.4071+3300

         .         .         .         .         .         .  g.909729
ttatttgacaatgaaaataaagcatatttagtttttacggctttcatgaaaaccacatca  c.4071+3360

         .         .         .         .         .         .  g.909789
tgttaaacataatatccttctcaaattctgttgtatcagcctgtgataagctgattagac  c.4071+3420

         .         .         .         .         .         .  g.909849
ctgaaagatacaatgttaaattaaaacaatgtgtagtaataggacttttgtatttctcag  c.4071+3480

         .         .         .         .         .         .  g.909909
gctttgctcagcactttgatcaatttcaaactacttaggtaaaaaagacacacctaataa  c.4071+3540

         .         .         .         .         .         .  g.909969
tttattagctaaatcaatcctttggatatttccactatctagttaaaaagactgttgttt  c.4071+3600

         .         .         .         .         .         .  g.910029
cgatgcagtagaataagccttgggataaattatctgagaggctgaagaaacaaaatgatt  c.4071+3660

         .         .         .         .         .         .  g.910089
acagtaactgagtttttaaatcaatttaaaaaattcttgttgtacattaatgtgttataa  c.4071+3720

         .         .         .         .         .         .  g.910149
tcaagaattctgaatttgttttaggccatgattctcttgatttttggttggttaaacaaa  c.4071+3780

         .         .         .         .         .         .  g.910209
aaagtttttattttgtggttattttctatttttattttattttatttttttgagacagag  c.4071+3840

         .         .         .         .         .         .  g.910269
tctctccctgaagcccaggctggagtgcaatggcacgatcttggctcactgcaacctctg  c.4071+3900

         .         .         .         .         .         .  g.910329
cctcctgggttcaagcaattctcctgcctcagccagatttgctattaataaacaaagtgc  c.4071+3960

         .         .         .         .         .         .  g.910389
cttttaatttgaagatgagccttaacctattttttaaaatcaattaagtgcctatgtcag  c.4071+4020

         .         .         .         .         .         .  g.910449
aggtttgtgaggtttttatatcacctacctaatgtttcttatagctgcaattatgcagaa  c.4071+4080

         .         .         .         .         .         .  g.910509
ctaaggtaacattcaattgcctgttaaatcagtcaaacagccagacttttattgcctatg  c.4071+4140

         .         .         .         .         .         .  g.910569
aatatttaaaagagatttgctagatcccatccctaatttcagagtgtgagtttgcattca  c.4071+4200

         .         .         .         .         .         .  g.910629
aataagtaataaattatttccatcacttcaaaaggcatctttcattcttgataatcatat  c.4071+4260

         .         .         .         .         .         .  g.910689
agcactatattttctactcacagtaatgatttgaaagatggttagcaaaccaggcaacat  c.4071+4320

         .         .         .         .         .         .  g.910749
ctccaacagacgtaccaaatcatatcatttttacaactattgtaatagctttattctcta  c.4071+4380

         .         .         .         .         .         .  g.910809
acagggtaaccaagcagcagaagatgatttagtaatacaacaaaatgaataataatattg  c.4071+4440

         .         .         .         .         .         .  g.910869
gtaatagtatttggttacagaggctcaggtacccttttaattgtcagatatgcattttct  c.4071+4500

         .         .         .         .         .         .  g.910929
catttagttctcacaatagccttatgatacatggtggtttttgtttttgttttttctttt  c.4071+4560

         .         .         .         .         .         .  g.910989
tttgagatggagtctttccctgttgcccaggctagagtacaagggtgcaatctcagctca  c.4071+4620

         .         .         .         .         .         .  g.911049
ctgcaacctcctcctcccgggttcaagcgattatcttgcctcagcctcccgagtagctgg  c.4071+4680

         .         .         .         .         .         .  g.911109
gattactggcacatgccactacgccaggctaatttttgtatttttagtagagatggagct  c.4071+4740

         .         .         .         .         .         .  g.911169
tcaccatgttggccaggctggcctcaaacacctgacctcaggttatccgcccgcctcggc  c.4071+4800

         .         .         .         .         .         .  g.911229
ctcccaaagtgcttgaattacaggcgtgagccaccgcatccggccgatatatggtttttc  c.4071+4860

         .         .         .         .         .         .  g.911289
atattcccattctacagaaattgaaaggatattaaaggccctaggaaaaagctattgagc  c.4071+4920

         .         .         .         .         .         .  g.911349
atttagacccatctctttacacttgaagcctaggcacgtgaccatttggctacactacct  c.4071+4980

         .         .         .         .         .         .  g.911409
ccaatctctgtgacccttttcatatattaaaaataaaaactctgctaataagtgaatatg  c.4071+5040

         .         .         .         .         .         .  g.911469
gcaattaacgagtttccccgtttttaaggaaagcttaaaacatggccttaaaagtattat  c.4071+5100

         .         .         .         .         .         .  g.911529
ggctgactaattaaaataaaatttagagtcttaaatattaaagtcacacattgagaagtc  c.4071+5160

         .         .         .         .         .         .  g.911589
caaagcctttaccacttctcttgatgagtgattatttcacctctttcgtggcttattaat  c.4071+5220

         .         .         .         .         .         .  g.911649
gcccgtatttcagtccctttcaaagatgtctgtaagttgttatgcctgacatgaaatagc  c.4071+5280

         .         .         .         .         .         .  g.911709
aaatttactgaaagggacaaaatctaaattggttaattcttctgtaatagtaacatttat  c.4071+5340

         .         .         .         .         .         .  g.911769
gatagactcagagagggccgtattaatttttcctggtaattatgactttgaatttttccc  c.4071+5400

         .         .         .         .         .         .  g.911829
tcagtgtcacatctaccttagcatagatagaccagaacggaagaacattgcttgaaggaa  c.4071+5460

         .         .         .         .         .         .  g.911889
gactataaagtaatctaggaaaataagtggcatattatgctttattaatttgtcaatatg  c.4071+5520

         .         .         .         .         .         .  g.911949
ttttgtagacaatatctgtctataataatagtaaaagccattactttttgagcacagttt  c.4071+5580

         .         .         .         .         .         .  g.912009
tacgtcagtccttttgctaagccgttagaagcaacatcaaacttaaatcccacatttgct  c.4071+5640

         .         .         .         .         .         .  g.912069
ttatgaaatagatttgattagcttacttcacagttgttgtgatagggctgacttctgttc  c.4071+5700

         .         .         .         .         .         .  g.912129
tcaagggctaggacagctaagtcttctgtaatgccctctggaaagcactaggatgctgga  c.4071+5760

         .         .         .         .         .         .  g.912189
aaatgtctagtagttgtattttatgttgctttcaaagaagtataagtaaacctttaaagg  c.4071+5820

         .         .         .         .         .         .  g.912249
ctaggaaaaaaatcagatgaaactgaagtcatgccgtaacatgcctatgaccactgacat  c.4071+5880

         .         .         .         .         .         .  g.912309
ttgtatggtggagataaaagctaagactgggaaccccaattttaggtgaattaagtcatt  c.4071+5940

         .         .         .         .         .         .  g.912369
tgatggaaaagaaatatgatcctctggctcacgaaaatggtggagctaaacacagattcc  c.4071+6000

         .         .         .         .         .         .  g.912429
acataaaactggggttctatcagtaagataatgggcagagagaattctatctgcagagag  c.4071+6060

         .         .         .         .         .         .  g.912489
aacaaacataaaaagacatctgtcttctcactgtgagtgcaaagtaatagaataattata  c.4071+6120

         .         .         .         .         .         .  g.912549
ataatgtcacctgaaaatgtgtgttggcctattcttgtaaggtgaggaactcttgagtgt  c.4071+6180

         .         .         .         .         .         .  g.912609
atattatcacaaagggtaaagaaatatccaaacaagtgattaagtcagggtagcaccagg  c.4071+6240

         .         .         .         .         .         .  g.912669
ttaggagcgtcctagcattagttagaagcaaatgcaaattgtttaccatgaaaagtgccc  c.4071+6300

         .         .         .         .         .         .  g.912729
tcagtgtcctcacagattaaactcaggggaacttgagctcatcataaacacatagacata  c.4071+6360

         .         .         .         .         .         .  g.912789
cacacactcactcacacgcacaagaaaagccctcatgaagcacagtcagcctatacaacg  c.4071+6420

         .         .         .         .         .         .  g.912849
aacggtgagtttacttctagaattccggatattagaattgcaagatgtatagtataaaat  c.4071+6480

         .         .         .         .         .         .  g.912909
aaataggtaaaatattatagaaataaatgttattgaagttataaaaaagaaaacattgta  c.4071+6540

         .         .         .         .         .         .  g.912969
aaaatggaataaagaaatcaaaattaaacaactacaattaaaaattagaaaatgaatata  c.4071+6600

         .         .         .         .         .         .  g.913029
tcatatataaacatattagttgaaagaaatgatttaaaagaaaactaaaagagaatgtac  c.4071+6660

         .         .         .         .         .         .  g.913089
agactgtgttaccaaaaactaaggaggtggaagatgtgaacaataggtaatagatacagg  c.4071+6720

         .         .         .         .         .         .  g.913149
ggtggggagtagaatatgaacatataacttatctcaatgggagttttcaaagaggagaat  c.4071+6780

         .         .         .         .         .         .  g.913209
aaagaaaatggagattattattattcaatataaaaaaattatataacccaatttaaaaat  c.4071+6840

         .         .         .         .         .         .  g.913269
gagcagttgagctcaaaaggcatttcttcaatgaagacctacatatggccaacatatata  c.4071+6900

         .         .         .         .         .         .  g.913329
tgaaaaggtgctcaaactcattaatcatcagggctatgtaaatcaaaaccacaatgatat  c.4071+6960

         .         .         .         .         .         .  g.913389
atgtcttcacatctgttagaatggcagttacttaaaaagaaaatcaagagatgacaagtt  c.4071+7020

         .         .         .         .         .         .  g.913449
tggcaagaatgtggagaaaagggccccttgtaccctgatggcaggaatgttaattcatgc  c.4071+7080

         .         .         .         .         .         .  g.913509
tgacactatggaaaacagtatggagattcctcaaaaaaaaaattaaaaatagaattacta  c.4071+7140

         .         .         .         .         .         .  g.913569
tatgatccagcaattccacttctagggatatatccaaaggaaattgaatgagaatcacaa  c.4071+7200

         .         .         .         .         .         .  g.913629
ggagattatctgcactctattgtttattgcagcattatttacaatagcaaagatatagag  c.4071+7260

         .         .         .         .         .         .  g.913689
acaacctaaatgtccattgacaggtgaaaggaaaaagaaaatgtgatatatacatacaat  c.4071+7320

         .         .         .         .         .         .  g.913749
gaaatattattcagcccttaaaaaataagcaaatcctaccatttcgctgtaacaacatgg  c.4071+7380

         .         .         .         .         .         .  g.913809
ataaacctggaggacattatgctacatgaagtaagccagacatagaaagacaaataatac  c.4071+7440

         .         .         .         .         .         .  g.913869
atgatcccaatcatattatgaatctaatacagtcaaactaatggaaggagaatgtggaat  c.4071+7500

         .         .         .         .         .         .  g.913929
gcttcctgccaggggctaggggaagggaaaaatggagagatatttgtaaaagggtacaat  c.4071+7560

         .         .         .         .         .         .  g.913989
gtttaggttatacaatatagataattcctagagatctactgtaaagcatattgcctatag  c.4071+7620

         .         .         .         .         .         .  g.914049
ttagtctatttacttaaactttgctaagaggatagaccttatgttaagtgttctgttaca  c.4071+7680

         .         .         .         .         .         .  g.914109
gaataataataatattagaataggaggaaagttttggagatgatgaataggtttatgtca  c.4071+7740

         .         .         .         .         .         .  g.914169
tagattgaggtaatgtttttatcagtgtatatttatctccaaactcagcaacttgtgtat  c.4071+7800

         .         .         .         .         .         .  g.914229
gttaattatatacagctttcttgtatgtcataatttttttgagaaatggagatggagtaa  c.4071+7860

         .         .         .         .         .         .  g.914289
tatatgaaggatattaaaggaaagtttccaagagccagtgacataaaccacttaaacaga  c.4071+7920

         .         .         .         .         .         .  g.914349
aagcacattatataacaggcaaagtaaataaatagaaatccaatctcagacatatcacag  c.4071+7980

         .         .         .         .         .         .  g.914409
tgaaagtgcagaaatccaaagacaaatttatattagcagctagaggtgagatggataacc  c.4071+8040

         .         .         .         .         .         .  g.914469
tacaaagcaattaaatttaggctgtcattagacttcttatctacaacaatgaataagaat  c.4071+8100

         .         .         .         .         .         .  g.914529
aaaaaagcaatggaaaatattttcaagatattgaaaaaattaccgtcaacctagaattct  c.4071+8160

         .         .         .         .         .         .  g.914589
gaactcaacaaaattagttcttcagagtaagaggaaattagacattatcagagtgaaaaa  c.4071+8220

         .         .         .         .         .         .  g.914649
aaagtgaaattttaccccaatagacccttactataaaaatgtctaaaataagtatgaaga  c.4071+8280

         .         .         .         .         .         .  g.914709
attagaagtagtagaaaaataagttttaaaggttttagatgcaataagtatgatgaaaaa  c.4071+8340

         .         .         .         .         .         .  g.914769
atagttaagcttttaaatacaaaaggcatttgttgcaaaaaatatataagaatatctaat  c.4071+8400

         .         .         .         .         .         .  g.914829
ttcatttaaaataatgttgatctaaaatactagattaaaaacaatatggaggggagttac  c.4071+8460

         .         .         .         .         .         .  g.914889
agccacaagcccttttatttagaaagagggtagagatagtgattaaatgtcgactttatg  c.4071+8520

         .         .         .         .         .         .  g.914949
ctgtaataaattgtcaaggataaccactaatggagcatccacctgggaaacaatcaaaga  c.4071+8580

         .         .         .         .         .         .  g.915009
atgataaaaggaacagttctcaatcagtacgcagtaaagcaagaaagaaggaaaacaaaa  c.4071+8640

         .         .         .         .         .         .  g.915069
cagaaaaatgtgagatgagcataaaataaaagaaaagatggtagaaaaatagaaatagaa  c.4071+8700

         .         .         .         .         .         .  g.915129
aaaaatagatggtagaaaaataccagcggccgggcgtggtagctcatgccttaatcccag  c.4071+8760

         .         .         .         .         .         .  g.915189
cactttgggaggccaaggcaggcagaccaggctgccaacaaggtgatacctggtctctac  c.4071+8820

         .         .         .         .         .         .  g.915249
cacaaatacaaaaaaaaaaaaaaaaaaaaaaaacccaaaaaaaagtatccaggcttggtg  c.4071+8880

         .         .         .         .         .         .  g.915309
gtgggtgcctataatcccaactactcgggaggctgagacaggagaatcacttgaacccag  c.4071+8940

         .         .         .         .         .         .  g.915369
ggaacggaagttgcagtgagctgagatcatgccatttcactccagactgggtgaaagagc  c.4071+9000

         .         .         .         .         .         .  g.915429
aaaactctgcctcaaaaaaaaaaaaaaaaaaggaaagaaaagaaaaagaaaaaaaaaata  c.4071+9060

         .         .         .         .         .         .  g.915489
catctgtagtcctagaactatttgctcaatacatttaatatataaatgtagaaattttca  c.4071+9120

         .         .         .         .         .         .  g.915549
gaataaagcatcaaaattcaaaatacattgtttttaagaaatacataaagacacatatat  c.4071+9180

         .         .         .         .         .         .  g.915609
cgaaaatggaaacagattttccgaaaaggattaatcaataaaaagcttagacacctaatt  c.4071+9240

         .         .         .         .         .         .  g.915669
tatttccagcaaaatagacattatggtcattatcattattaggcaaaaaatggagtaaaa  c.4071+9300

         .         .         .         .         .         .  g.915729
tataacagttctaaaacttgtacatacctggccgggcatggtggctcacgcctctaatcc  c.4071+9360

         .         .         .         .         .         .  g.915789
cagcactttgagaggccgaggtgggtggctcacctgaggtcaggagttcgagaccaatct  c.4071+9420

         .         .         .         .         .         .  g.915849
gggcagcatggtgaaaccccgtctctgctaaaaatacaaaaattaaccagctgtggtggt  c.4071+9480

         .         .         .         .         .         .  g.915909
gcacgcctgtagtcccagctgcttgggaggctgaggtgggagaattgcttgaatctggga  c.4071+9540

         .         .         .         .         .         .  g.915969
ggcagaggttgcagtgagctgagattgcagtctccactccagcctgggttacggagtgag  c.4071+9600

         .         .         .         .         .         .  g.916029
actctgtcaaaagaaacaaaaaaatctcgtacatacctgggaaaatacctttaaaacacg  c.4071+9660

         .         .         .         .         .         .  g.916089
taaagcaaaaatccacagaataacaagaagaaatacacaactatatcagcatggtgggag  c.4071+9720

         .         .         .         .         .         .  g.916149
atttcataatgcctctttctttcaagacaccagacaaaagttagtgaagatagtgatgat  c.4071+9780

         .         .         .         .         .         .  g.916209
taacagttgataaggtggatataaagactgtatagagaaccccaaatcagagtgtaaatt  c.4071+9840

         .         .         .         .         .         .  g.916269
tcatctgaagtacatggaaatgtcaatacatttcacatatttggtattattagggaaata  c.4071+9900

         .         .         .         .         .         .  g.916329
ctcttaaatttgtaacaagctagaatcaatagtaaaaacttgactaaagtaaataatttg  c.4071+9960

         .         .         .         .         .         .  g.916389
tggatcaaagatgaattcaaaatggatggttaaaattcatagaaccgagtgataataaaa  c.4071+10020

         .         .         .         .         .         .  g.916449
ataaaaattaaaactaattggttcctgttaatttttgtagaagagacggaagggctgaaa  c.4071+10080

         .         .         .         .         .         .  g.916509
actagtgagctaactgcccatctcaagaaaatagggaaaagtataataaatgcagagaaa  c.4071+10140

         .         .         .         .         .         .  g.916569
gtaaatggaaagagaagaattcaagagcagaaataaataaaaacaacatggaatcaataa  c.4071+10200

         .         .         .         .         .         .  g.916629
aatttaaatgcccatattcatgttttaattagacaaatcaactgagagggaagtaaaaac  c.4071+10260

         .         .         .         .         .         .  g.916689
aaatataaaatcttaaggatgaaaatgttataactacagttataatatatttttaaaata  c.4071+10320

         .         .         .         .         .         .  g.916749
cagaaaatactaaaagctatgcaaataagtttagaaacttacatgaaatggatgaatttc  c.4071+10380

         .         .         .         .         .         .  g.916809
taggagaatattgctacaaaaatgatggaaggggatatagaaagcctgaggagacagaaa  c.4071+10440

         .         .         .         .         .         .  g.916869
tttaatcacaaattaaaagtcttcctacaaagactatattagactgaaattattttacat  c.4071+10500

         .         .         .         .         .         .  g.916929
tcaaatttgaacacactttctaggaatagataattccagtcatcaacaaactcagtagaa  c.4071+10560

         .         .         .         .         .         .  g.916989
catacaaggcaatatacatgtctggaaaatataaggttagaaaattttttttttttttta  c.4071+10620

         .         .         .         .         .         .  g.917049
ccaaaatcagacaaaaatgaaacaggaaggaaaaccccatgccaatttcagtcataaatt  c.4071+10680

         .         .         .         .         .         .  g.917109
aataaggaaaagttctgaaacaaattattggccaactggatccaagtgtgtatgaaacag  c.4071+10740

         .         .         .         .         .         .  g.917169
tgtttaagcttaatgttctccctttcctttctatattcactctttataatactttatgca  c.4071+10800

         .         .         .         .         .         .  g.917229
gtgtcatggctttaaataaaatttacatgctaattattcccaaaatattatctctggcac  c.4071+10860

         .         .         .         .         .         .  g.917289
agacttttgcccttaacttcagaccatatatccagccttctattgtgtatttttctcttt  c.4071+10920

         .         .         .         .         .         .  g.917349
ggatatctcataggctactcaaacttaacatactcagatgacagctcctatcaaagctac  c.4071+10980

         .         .         .         .         .         .  g.917409
ccaacaccgttttctccacctctgttaatgccatctcattcctgaaatttctcataccaa  c.4071+11040

         .         .         .         .         .         .  g.917469
aacttttaaaatgaactttgattcttgtctttctttaccagcctttctcttagcagatct  c.4071+11100

         .         .         .         .         .         .  g.917529
gaaagatggtctcaacagatctagctgttgttttacttttatgttctgggtatatatgca  c.4071+11160

         .         .         .         .         .         .  g.917589
ggtttgttatacaggtaaacagtgtgtcatggggggttggtgtacagattatttcatcac  c.4071+11220

         .         .         .         .         .         .  g.917649
ccaggtaataagcatactacctgataggtattttttctgatcctccccttcctcccattc  c.4071+11280

         .         .         .         .         .         .  g.917709
tctatcctcaagtaggacccagtgtctgttccctcattgtgtccatgtattctcattatt  c.4071+11340

         .         .         .         .         .         .  g.917769
tagctcccacttataagtgagaacatgtgatatttagttgtctgttcctgcattagtttg  c.4071+11400

         .         .         .         .         .         .  g.917829
ctaagtagaatggtctccagctccctccatgttcctgcaaaggacacgaactccttcttt  c.4071+11460

         .         .         .         .         .         .  g.917889
ttgtggctgcgtagtgttccatggtgtatatgcaccacattttctttatctagtctacca  c.4071+11520

         .         .         .         .         .         .  g.917949
tggagggcatttaggttgattctgtatctttgctattgtgaatagtgttgcaatgaacat  c.4071+11580

         .         .         .         .         .         .  g.918009
atgtgtgcatgtgtctttgtggtagaacaatttgtattcctttggctatacacccggtaa  c.4071+11640

         .         .         .         .         .         .  g.918069
tggggttgctgtgttctgtttttagctctgccaaactgctttccacaagggctcaactaa  c.4071+11700

         .         .         .         .         .         .  g.918129
tttacacccccaccagcagtgtataaatgttctgttttctctgccatcccaacagcatct  c.4071+11760

         .         .         .         .         .         .  g.918189
gttattttttgacattttaataatagccattttgactggtgcgagatggcatcttatcgt  c.4071+11820

         .         .         .         .         .         .  g.918249
ggttttaatgtgcacttctctaatggttggtgatattgagcattttttttcatattgttg  c.4071+11880

         .         .         .         .         .         .  g.918309
gccacatgtgtgtcgtcttgtgaaaaatgtgtgttcatgtcctttgcccatttttaatgg  c.4071+11940

         .         .         .         .         .         .  g.918369
agtagagtttttaaaataaatttgtttaagttacttagagattctggatgttaaaccttt  c.4071+12000

         .         .         .         .         .         .  g.918429
atcagattcacagtttgcaaaatatttctcccgttctgtagtttgtctgtttactctgtt  c.4071+12060

         .         .         .         .         .         .  g.918489
gacagagttcaacagaggaactctgtgaggaagttgtgtaatttaattaggtctcatttg  c.4071+12120

         .         .         .         .         .         .  g.918549
tcagtgtttgcttttgttgcaattgcttttgacatcatcattacatcttttcccattcct  c.4071+12180

         .         .         .         .         .         .  g.918609
atgtccaggatggtattgcctaggttatcctccagggtttttaaagttttgctttgacat  c.4071+12240

         .         .         .         .         .         .  g.918669
tttaagtctttcattcatcttgagttgatttttgtatatggtgtaaggttttattcttct  c.4071+12300

         .         .         .         .         .         .  g.918729
gtatacggttagccagttatcccagcaccatttatggaatagggagtcctttcctcattg  c.4071+12360

         .         .         .         .         .         .  g.918789
cttgcttttgtcggctttgtcgaagatcagaagggtataggtgtgtggcattatttctgg  c.4071+12420

         .         .         .         .         .         .  g.918849
gctttccattctgtttcattggtctatgtgactgtttttgtaccagtactgtgttgtttt  c.4071+12480

         .         .         .         .         .         .  g.918909
ggttactgtagcactgtagtatagtttgaagtcagctaacatgatgcctccactagctgt  c.4071+12540

         .         .         .         .         .         .  g.918969
atttctttgctccttctctcattaaatatagtctctgtgttccaaagtgaggaggaacaa  c.4071+12600

         .         .         .         .         .         .  g.919029
ctgtgagattaagatttggtaaaagagaaaatgagcagggcaaatagagacaataaatct  c.4071+12660

         .         .         .         .         .         .  g.919089
gtgatgatgaaaaaatgagaaagaaaggccagtaactgaaattgaatagtaatagggcag  c.4071+12720

         .         .         .         .         .         .  g.919149
aaaagatgtgttgttgattttcaggataataaaaatttaagcatgtttgtagtataaggg  c.4071+12780

         .         .         .         .         .         .  g.919209
aagatccaatagaaagacataatatataagagcaaagtcttacaagataggatacacgag  c.4071+12840

         .         .         .         .         .         .  g.919269
caaaaaaaatggaaggattgactttggaagtgggaaagagaaaattgagataatacaagg  c.4071+12900

         .         .         .         .         .         .  g.919329
aggttctgaggtggagagtagtaagtttgagaaagtttatccaccaaggataaatttatc  c.4071+12960

         .         .         .         .         .         .  g.919389
cctgagaagtaggtaactctgttttcaggttgtttaggactctgcacggtaaagggggtt  c.4071+13020

         .         .         .         .         .         .  g.919449
gggagaaaggagaactggtgtcattgaggaaatgagagtgaaaagtatttggaataggag  c.4071+13080

         .         .         .         .         .         .  g.919509
ctcttttgttttaaagattcgtttaaaatcaggagaagtgttagagaataatatcgtgga  c.4071+13140

         .         .      g.919533
ctcagtagtagccaatgaagttat  c.4071+13164

--------------------- middle of intron ---------------------
                       g.919534         .         .           g.919556
                       c.4072-13163  tcgcaatggaaataatcagttat  c.4072-13141

.         .         .         .         .         .           g.919616
ctgactttctcccgtaattttctgcaaaataattttatttagaaccacacacatacagcc  c.4072-13081

.         .         .         .         .         .           g.919676
gcatagaaaatcaaaagcgaagggatttttctttgcgttatctttgattagcatctccag  c.4072-13021

.         .         .         .         .         .           g.919736
gttgtatttgattatattctgaaacaactaggattctagtctgaagtatcttcttccaac  c.4072-12961

.         .         .         .         .         .           g.919796
tatattcatatttgcaagtcattcatctggttaccgccagtatgtcaaatgtgaatttca  c.4072-12901

.         .         .         .         .         .           g.919856
tgtatttttttttttttttttacaatctctctaacttaaccaatttaattcagattttta  c.4072-12841

.         .         .         .         .         .           g.919916
tgtcagtcttttagctgttggctgtttttcccaaaatgtcaggatcggctccataatttg  c.4072-12781

.         .         .         .         .         .           g.919976
ggggactcagggaagaaagaaaatactgggtcccatactcaaaaattaagcattgtaaga  c.4072-12721

.         .         .         .         .         .           g.920036
tggcaacagcagagcattaaaccaagcatgggctctcctaagcatgagttactgcataac  c.4072-12661

.         .         .         .         .         .           g.920096
tgcacaggttgcatggctttgaagccaatttcgggtgtcatcttatacatttggttattt  c.4072-12601

.         .         .         .         .         .           g.920156
gtacacctgaaatgcttttgataaggtttgggagttaacaatttaggctcacttttatag  c.4072-12541

.         .         .         .         .         .           g.920216
attatcattacttgaaaatatttcattgaggataattaattaacaataaatgctttaata  c.4072-12481

.         .         .         .         .         .           g.920276
tttagaaaggtgaaatttaatcttattcttagtgtgttaataatggatatagcttctagg  c.4072-12421

.         .         .         .         .         .           g.920336
tttacatctttccatactttgaattcagggctttctttccttaagtagtaaaaaggatat  c.4072-12361

.         .         .         .         .         .           g.920396
tggatatcttgaatcttgacttctcctaggttgaatgctctgcaaaaaacctttgtcttt  c.4072-12301

.         .         .         .         .         .           g.920456
atataaaaattgcactgcaagcagactattatggcagacctctgtgttcaaggtgactgc  c.4072-12241

.         .         .         .         .         .           g.920516
aattttcagctgagtggtggactatgcaacttgttctcataataatattaattgaataaa  c.4072-12181

.         .         .         .         .         .           g.920576
tggtcaagagtgattacattttgaggggaagaaacccacttgtgtaatatttacacatag  c.4072-12121

.         .         .         .         .         .           g.920636
ataataaactcaatagcccagacctctttaatgtaagaaaaatagacatgaatgtgtatg  c.4072-12061

.         .         .         .         .         .           g.920696
ctattttctttgtaaattagaaatttttccttctctatttcatgtatcttcttttgttat  c.4072-12001

.         .         .         .         .         .           g.920756
ttgagaaagggatttttcttgtcctaccatcaattgtgtgagttaccttgattcttgttt  c.4072-11941

.         .         .         .         .         .           g.920816
ttaataatattttaaaatacatcttgtattttaaatgtagttaccctctattttatagct  c.4072-11881

.         .         .         .         .         .           g.920876
acaggaactgaaagagtacatagccttcacaaaagggtctgtggtgaatgtgtttaattc  c.4072-11821

.         .         .         .         .         .           g.920936
ttattttaatcaccatgaatcatggattttttctttgtaagtagtaattccattattttt  c.4072-11761

.         .         .         .         .         .           g.920996
agatataatttaccctacttcaatcaataatgtttccttggacagtcatatttacttttc  c.4072-11701

.         .         .         .         .         .           g.921056
cgaaatattatataaaacagtagttaaatgtttttgttcgtctgtatgcctattatagaa  c.4072-11641

.         .         .         .         .         .           g.921116
tattagcatttttggggtccagacacaaagggacacacaaacacatatatatacttgcat  c.4072-11581

.         .         .         .         .         .           g.921176
gtatttatatatacatgtatataagcacatatgtatacatataatcatgtactgcatttc  c.4072-11521

.         .         .         .         .         .           g.921236
aatatatgattaatatttaagtatttaatattcactctagacaaattatgtttgctcttg  c.4072-11461

.         .         .         .         .         .           g.921296
gagggcattaatatctttgtgaatgagtgttaacatatccatttaatggtatcttgtctt  c.4072-11401

.         .         .         .         .         .           g.921356
caaatatctcataatttgatagttgagttatttcttctgaagttggaatagcttttctac  c.4072-11341

.         .         .         .         .         .           g.921416
aagggcctaccaaaaaaaaaaaaaaagaataataaagttggaataacaaaagagggagtt  c.4072-11281

.         .         .         .         .         .           g.921476
aatacataaaggaaaaccattaaggccgaaaaactaatcagttgtaaaagctaaatcagt  c.4072-11221

.         .         .         .         .         .           g.921536
agtatggattgataaagtagcattttagtgataaatttttggattgaagtttctctttta  c.4072-11161

.         .         .         .         .         .           g.921596
agtttatcaatgtaccttttcagaaaaattcctcgagtttatatctttatgttaatgaaa  c.4072-11101

.         .         .         .         .         .           g.921656
cttgtcaataactttaattatctatgatgattgacaactaatacttaatttctataacac  c.4072-11041

.         .         .         .         .         .           g.921716
acaatactgttctgagggtacatattcatctctctctttcatcttacgttttaccactct  c.4072-10981

.         .         .         .         .         .           g.921776
caactttttaaaaccgttttctttgcaagctacttcatagattcttgagattgaataatc  c.4072-10921

.         .         .         .         .         .           g.921836
aaatctgttatttaatattcaggccaaatttctgaaaatgtttatttttttaaaaaaaat  c.4072-10861

.         .         .         .         .         .           g.921896
gataaatggaaaagggaatgttaaacaacatttctttgcagtgtattccagtgtccctag  c.4072-10801

.         .         .         .         .         .           g.921956
atggaatgaggaataaaaatatttttcaagttcatcatgctgtcttttaaatcataaaat  c.4072-10741

.         .         .         .         .         .           g.922016
gcatatatttattagtaatttttcattgaaagtatcaaagaaaattggagaatttcctta  c.4072-10681

.         .         .         .         .         .           g.922076
ctgtttctacctcactatgtttcgtatattctgaccagcattaataccaatttcatagca  c.4072-10621

.         .         .         .         .         .           g.922136
ctctactgttcgctcttttttgctgtaagcccaactgattgcattttcttacctgttatt  c.4072-10561

.         .         .         .         .         .           g.922196
tttcgttgttgttatttaagacatcttttctttctaacttcggtcttcatagaccttctc  c.4072-10501

.         .         .         .         .         .           g.922256
aatttcagctcatcaccaaaattacacagatagaagaatatagggactttggtgtacaca  c.4072-10441

.         .         .         .         .         .           g.922316
tacccacttttgactccctctgattttctaatttagtagattttaattgaggctgagaac  c.4072-10381

.         .         .         .         .         .           g.922376
tgtatttggaaaagttcattctgatgattattcaggtttgtgaaccccagtctagataga  c.4072-10321

.         .         .         .         .         .           g.922436
cctttatcagcacatgtataaggtgcactttgctaaggtgcattatgtgtcaggttcatt  c.4072-10261

.         .         .         .         .         .           g.922496
cccactgtggaccagtaatttattcttgcccaaccactgctcatgacagatagatgatct  c.4072-10201

.         .         .         .         .         .           g.922556
ctgtattccagaaatgaagctcctttccaattcctcaacaactaaaccaagcagaggaaa  c.4072-10141

.         .         .         .         .         .           g.922616
aagtggttttccttcacagccatagttccctgctgaagtagaatgaacgctttctaggaa  c.4072-10081

.         .         .         .         .         .           g.922676
actgcagcagatttttgatgacacggaaagggcatcactaggatcctcattatatattac  c.4072-10021

.         .         .         .         .         .           g.922736
ctctctccctcacccgaaccacaatgttgacggaacagatacttcctgtggggaagatgc  c.4072-9961

.         .         .         .         .         .           g.922796
taagcagtcctgcatggctgtaggcattgtccacatcttaatcttcagctatatctgagg  c.4072-9901

.         .         .         .         .         .           g.922856
tatgacaagtttaacaatcctacaagttaaagcgtcacaccggaaacctgtttattcttc  c.4072-9841

.         .         .         .         .         .           g.922916
tcccatgccaaataattccagcacgatgggtttcatctatagacgatgagaagatgccat  c.4072-9781

.         .         .         .         .         .           g.922976
tgtggggtgaggacatagagaagagaggaagtttggaaccagtttatttctatttcagca  c.4072-9721

.         .         .         .         .         .           g.923036
agcttaatgtattgtaagaacattttgtggcagatgaccctagtctgtaacaaggaatcg  c.4072-9661

.         .         .         .         .         .           g.923096
attgtaatgcatcattctgccagtgtttatctgttccctatgctcatataaacacacgag  c.4072-9601

.         .         .         .         .         .           g.923156
tcatctttctgcactcccaacctactcctaaagcactatacagaatgtttcgaaagcaga  c.4072-9541

.         .         .         .         .         .           g.923216
aggaaaagcagctgttccatacaccatgttcctgctgttcaaggtgcacatcccatccaa  c.4072-9481

.         .         .         .         .         .           g.923276
atgaatcatatcagagccaaagatcctggtaggagttcttttctacaaaactgcagtctt  c.4072-9421

.         .         .         .         .         .           g.923336
gtctatcctaacaacttggaggacaaaatattagaaaaccttgtaataaccttaggacac  c.4072-9361

.         .         .         .         .         .           g.923396
aataatgtagatactgactgagctagacctgaggactttttcaatgtagtgtggataagt  c.4072-9301

.         .         .         .         .         .           g.923456
aagatgacaggaagccataagcatactgtgccttgcacatcaacttctccagagccatga  c.4072-9241

.         .         .         .         .         .           g.923516
caatcatctggagtatttgtgataaataaatattgttaatcttcatgtaattgggtagga  c.4072-9181

.         .         .         .         .         .           g.923576
tgaaaaaggaccagtcgtcccagacatcccaggagagaggagcatttttccagttgctca  c.4072-9121

.         .         .         .         .         .           g.923636
gatacaatttcaagttcgaaccaatatgaattacagttgaccacagaggccggcaaaatc  c.4072-9061

.         .         .         .         .         .           g.923696
catggcactgtagtccaagagaacctgaacactggccttagagtattatgagcctacatc  c.4072-9001

.         .         .         .         .         .           g.923756
acagtagaaggaatccagcagagatctctaatgcacatcagaaaagcaccatttctagtt  c.4072-8941

.         .         .         .         .         .           g.923816
atcaaggctgtatttcacactgcttgactgaagattggaaactattttattcataggcaa  c.4072-8881

.         .         .         .         .         .           g.923876
cctgtgtggccatccttacctggtctataaaaggaagtgtgatgaatttgcttcccatac  c.4072-8821

.         .         .         .         .         .           g.923936
atcatattaagtccagaaagccagagatgctgtgttgagtttctttcctgagagtctgaa  c.4072-8761

.         .         .         .         .         .           g.923996
ttcctaagtagagggactaacgagttccaaagttctttcactctgagatctttgtcacac  c.4072-8701

.         .         .         .         .         .           g.924056
tactgtactgactggatatcactgaccttatttaagaggactatcaactggctagttcat  c.4072-8641

.         .         .         .         .         .           g.924116
ctacattgtaaggactagtttgctcacaaccaccaacctatctgtaattggcctcagtat  c.4072-8581

.         .         .         .         .         .           g.924176
gctctctctcacttgggtacttctgtatttggctaattaacctataccacttggcttaga  c.4072-8521

.         .         .         .         .         .           g.924236
agcaccagctacattttttctaattttgacttctcatcttttccaacttgattttatccc  c.4072-8461

.         .         .         .         .         .           g.924296
cagatttggacttttgtctcatgtataaactttatattttgcttgaacatgtggtctcaa  c.4072-8401

.         .         .         .         .         .           g.924356
tgctgaccaagtcatccctagaatctgattctgtctcactattccatatcaggagacagc  c.4072-8341

.         .         .         .         .         .           g.924416
gacttaaatattttaattatttcctgtatcaataaattattcactgcctaaagtttagac  c.4072-8281

.         .         .         .         .         .           g.924476
tttaataatatgaacacatgtgcagtcaaagagtacctcgccattgggccggaaaaattt  c.4072-8221

.         .         .         .         .         .           g.924536
cactgacttagggtggctcctgaaggtaccttgagaaagcttggatatgatgaatcctgt  c.4072-8161

.         .         .         .         .         .           g.924596
agacttattttatgtttactgaataatgcttcattcactttctttttgaagcttaaataa  c.4072-8101

.         .         .         .         .         .           g.924656
agcatcagtttgctcctgtcagggcagaagaccaatttcacttgtctacccatgaggata  c.4072-8041

.         .         .         .         .         .           g.924716
aatggatgcagcaagaatccagaaatgtcttagatatattactctatagctcattgacca  c.4072-7981

.         .         .         .         .         .           g.924776
ttctatcaatgctcaatgctttacttgaaagtgatggctatctgatgtcaagttccattg  c.4072-7921

.         .         .         .         .         .           g.924836
ataaaatgattcccaaacgttactttcaagtatgcttccttcagaggtcacagaagaact  c.4072-7861

.         .         .         .         .         .           g.924896
tcagtaacctgctaaaacctaaaacaggtgaagttcctattaaccatgacaccaagagtt  c.4072-7801

.         .         .         .         .         .           g.924956
ttcacatttatattctttcctggtaaagaaaattataggagctccatgctcacggctttt  c.4072-7741

.         .         .         .         .         .           g.925016
gagttttctcccaggtgtgttcaaacctagtgacattaacaaaacataaatctagaagcc  c.4072-7681

.         .         .         .         .         .           g.925076
tttcgtgaataatgtaaccttctttattttatatttaaaggatatatatgcagacatgta  c.4072-7621

.         .         .         .         .         .           g.925136
cacatctttgtaattatttaccgcctatatccctattaaatacattaacaaatatgccac  c.4072-7561

.         .         .         .         .         .           g.925196
aggaaaaaccactgtaccaaagcccctcacaagagttatatttaaagtgggttaaagcaa  c.4072-7501

.         .         .         .         .         .           g.925256
catggttttaatttacttagtctttcttgtccaaggaacacagtgtgagacctcctttct  c.4072-7441

.         .         .         .         .         .           g.925316
ttaggaaaaaataggatgaactaatttgaaaacaaagaaagcaacaaagtgaatcttgtg  c.4072-7381

.         .         .         .         .         .           g.925376
atgagctatgagcattggtaaattatttcttctgttgtaaattatcctcttctccctctg  c.4072-7321

.         .         .         .         .         .           g.925436
cttttctcttaatctccatttaattcccttttcaaaatcctaactctattctttttggaa  c.4072-7261

.         .         .         .         .         .           g.925496
aacatttcattaagctggtataagcatatctagacatctggaaatttttgtataactttt  c.4072-7201

.         .         .         .         .         .           g.925556
aaaggatctattacttaacaccatatgaaattatggaaaataaagtgttcctatctaatc  c.4072-7141

.         .         .         .         .         .           g.925616
aatctcaaagatttttcaagtgtacaatacaatgtgtgcttcaagtgtcagcttcttttt  c.4072-7081

.         .         .         .         .         .           g.925676
tttttttttttttttttttttgagacagagtctcactctgtcacccagactgtagtgcaa  c.4072-7021

.         .         .         .         .         .           g.925736
tggcacgatctcagctcactgccagctctacctcccgggttcacaccattctcctgcctc  c.4072-6961

.         .         .         .         .         .           g.925796
agcctcctgcgtagctgggactacaggcgcctgccaccatgccaggctaattttttgtat  c.4072-6901

.         .         .         .         .         .           g.925856
ttttagtagaaacagggtttcaccgtgtcagccaggatggtttcgatctcctgaagtgtc  c.4072-6841

.         .         .         .         .         .           g.925916
aacttctttaaggctgtcatcttgccggttctaaacaactaaaaattgtaagaaccaatt  c.4072-6781

.         .         .         .         .         .           g.925976
tctgagacaaatagaacattcttagtggtccttaaataattcctgatacttttatggcat  c.4072-6721

.         .         .         .         .         .           g.926036
gcttctttaaagaccttagaattatgcttcaggaatttaaattggttgttcagcaaagtt  c.4072-6661

.         .         .         .         .         .           g.926096
accaatcagtaggcaagttgttgcatttgacaggagcaatagttttcacgtggattattt  c.4072-6601

.         .         .         .         .         .           g.926156
atattcatgtatgttggtagacggatataaaacatgcaacttgcagttgcatgagacaaa  c.4072-6541

.         .         .         .         .         .           g.926216
agcatcaacatatctatcttagcttttcaatcatgtgatactactataatgctccatttt  c.4072-6481

.         .         .         .         .         .           g.926276
tcacagatatttcttaagttctttatctcttcagacctcccgtaaaccattttctgtctt  c.4072-6421

.         .         .         .         .         .           g.926336
ctgctggaccacattctagatgatctggatgtctatcattctcctttgcctttgctttat  c.4072-6361

.         .         .         .         .         .           g.926396
ttgagtaagtgctgaattcgtggactgtgttagtagtttgatgcgtagtttcagccagat  c.4072-6301

.         .         .         .         .         .           g.926456
agatcagaaacatgaaatgcttttacatcatccaggtagatggcgccatgaatagatccc  c.4072-6241

.         .         .         .         .         .           g.926516
tttgctttctggcctctgaggtaataaagacttaaatctaattgggttcagcttaaaatc  c.4072-6181

.         .         .         .         .         .           g.926576
tcaatgtcatatttaatttaatatgcttccttgtttccagctcaagcttaagccatggtc  c.4072-6121

.         .         .         .         .         .           g.926636
taaaagactttctctggaaggcaagtgtggttagattccatcttacacctccactgcctc  c.4072-6061

.         .         .         .         .         .           g.926696
tttttcttttttttttttttaactgcacttcagttatattattctccaatgtcttgggaa  c.4072-6001

.         .         .         .         .         .           g.926756
gtaggagttaaggaaaataggcaaatgtctcctgttaactagctatttgtagctttgagt  c.4072-5941

.         .         .         .         .         .           g.926816
ttatgatttgtgtgtgtgtgtgtgtgtgtgtaacagagatacaaagttcgggtttatttg  c.4072-5881

.         .         .         .         .         .           g.926876
gggtacaagtatgggatctttaagaagtcttgcagaagctcttttgttttccccatcttt  c.4072-5821

.         .         .         .         .         .           g.926936
aagaaggaaaatatgctctataaaaacatcttcaagcctcttgatcctgaggtactcttg  c.4072-5761

.         .         .         .         .         .           g.926996
ctccataaagagtgttcctggtagatagctcaaacatggctgtcttcttccacgttcact  c.4072-5701

.         .         .         .         .         .           g.927056
tgacctattgagaaacgtttgccacaccaagcactggggagtacaggctgccccccttct  c.4072-5641

.         .         .         .         .         .           g.927116
tcactgtatcatttctcattcattttttacctatcaagtaggcatataatttctgaagca  c.4072-5581

.         .         .         .         .         .           g.927176
gacatcttcagaagcagagttggtaattaggtgtcatccctatctactctggactcccag  c.4072-5521

.         .         .         .         .         .           g.927236
accctgtgatcagtggtcttggagctccacttacttgcatgggacaaaaaggttgaagta  c.4072-5461

.         .         .         .         .         .           g.927296
ccatcttcttttcccccttacggaataaacagagggagccatccctactctccctctggg  c.4072-5401

.         .         .         .         .         .           g.927356
ccatgaattcagaagaccgattctttctaaaaccttcagagagttttagtataagtgggt  c.4072-5341

.         .         .         .         .         .           g.927416
atggtggagcaacaaaggcagggccagttttcccagctcttttgtaagccctttgctatg  c.4072-5281

.         .         .         .         .         .           g.927476
ccctgctatttccatctcttagaatgagagagacttattacttgttattttcagtttaag  c.4072-5221

.         .         .         .         .         .           g.927536
actatacccaaaattctaagacaacagatagaattcaatgcattcatatccatagtgaca  c.4072-5161

.         .         .         .         .         .           g.927596
gtttcacacttgctcttaagttaaatagaagagttaggtcaggaggaaatagtttatcaa  c.4072-5101

.         .         .         .         .         .           g.927656
aaatgatatacacccaccagtattcttagtacttggcacttgaacaaattgcaacctgtt  c.4072-5041

.         .         .         .         .         .           g.927716
agtaggtaaaaaagaaacactaaaaggaaatagttggaccactgaactattgcttgatcc  c.4072-4981

.         .         .         .         .         .           g.927776
actgaagcaagtgttgcttggtccactgaagttgagactctgggaaagaaaacttgactg  c.4072-4921

.         .         .         .         .         .           g.927836
gtaaactctgtgaagtgaagcgtggttgtcaaatggagattaatgtcctctcatgggtct  c.4072-4861

.         .         .         .         .         .           g.927896
ccactgtagtttctgaagggcaggttgagtaggatttggttttagcacatctcttgcagg  c.4072-4801

.         .         .         .         .         .           g.927956
actcctatcccaagacactttctataaaataaaacatattccatattgctctactttctg  c.4072-4741

.         .         .         .         .         .           g.928016
caaggtacggacagtcaggttggggccaattaatgcactaccctaagcagaaacttcaag  c.4072-4681

.         .         .         .         .         .           g.928076
actttgtcgttgctttgctttatttgaattggaatttgggatttagttttcgttagttca  c.4072-4621

.         .         .         .         .         .           g.928136
tttactactaaaatcactcataaaaatgagggctttattttgacattggcaaaaatcctt  c.4072-4561

.         .         .         .         .         .           g.928196
ctttactcagaagaaaatatttaaaactgctggaaattgaaatgttttacatgtctacat  c.4072-4501

.         .         .         .         .         .           g.928256
cacaatgatgaatacaatgatgagtatttaaacaccaaaaataaaagtgtcttattacga  c.4072-4441

.         .         .         .         .         .           g.928316
gatgattgtaaacagtgcacccacattcttaatccatttgcaagcataagcttacccatc  c.4072-4381

.         .         .         .         .         .           g.928376
acctcataaatgcagtaaaattgctttttgtattgagtttaataagtatagtataggata  c.4072-4321

.         .         .         .         .         .           g.928436
cctagctcctttaatgaatgtgttttttgtaaaatattattaaatgattttttttctaat  c.4072-4261

.         .         .         .         .         .           g.928496
ttggctttttaaagcatgcattcatatgttaaatacattttttggtttcaatattcggtt  c.4072-4201

.         .         .         .         .         .           g.928556
ttttatttcacatgcagagttttctcttccagagtttcttagacatgctacactttgatt  c.4072-4141

.         .         .         .         .         .           g.928616
tatgtgtttgtaatattgtggtacaaaggttagtacattatttttaaaatggaaatgtga  c.4072-4081

.         .         .         .         .         .           g.928676
gaaactgtcaattcattgtagagatgactttacattgccagcaaaactcattaaactctt  c.4072-4021

.         .         .         .         .         .           g.928736
aaaactttttcttaaacttattttatatttccatagtactttaaagatataaaataatta  c.4072-3961

.         .         .         .         .         .           g.928796
atttgtgttaacttttacttagttttaattttcattgaaaactgggttaaaatatattat  c.4072-3901

.         .         .         .         .         .           g.928856
gtgtttttcttggtaaccattactaggattgttttctatttttatatttttgtcattgat  c.4072-3841

.         .         .         .         .         .           g.928916
cgccagttattaaaagatgtctttctaactttccttatatttgctgtttctgtctagcta  c.4072-3781

.         .         .         .         .         .           g.928976
tataattcctcttactgctaagtggattagctaaagacatgaaataacattttaaaacaa  c.4072-3721

.         .         .         .         .         .           g.929036
cagcggaacagtattctggaacaacaacaaaaaatcagattatggttgaagactttctac  c.4072-3661

.         .         .         .         .         .           g.929096
aaacttcattcaatgagacagcacaggtcaagcgggcagaaagtcagaaaattcataagc  c.4072-3601

.         .         .         .         .         .           g.929156
ctgacattccatcagggtgcgcctaatcagatgtttagaaatagaaggcagcttatgcca  c.4072-3541

.         .         .         .         .         .           g.929216
tgactagttgaaagaattctgcaagcttgcattgacatgaggtcttttcaatgactgaga  c.4072-3481

.         .         .         .         .         .           g.929276
taatcaaggaatctgtgtaaatcagcctctcttattgactgtcaggccaggaaaagagcc  c.4072-3421

.         .         .         .         .         .           g.929336
aacccacccgaagtcaactctgccatcatttcttaagccacactgttcctttcagctcat  c.4072-3361

.         .         .         .         .         .           g.929396
agaatctcatgaatagaaaaagttaggtttctaaaaagaattttgaggctagatatgtgg  c.4072-3301

.         .         .         .         .         .           g.929456
tttaatgttattctatattacatcctatacaattaaaatctacagatgtgccttgtagag  c.4072-3241

.         .         .         .         .         .           g.929516
tacactgtttttgcctttagccagaggaaggaccaaatttaatacctggctaggcaatta  c.4072-3181

.         .         .         .         .         .           g.929576
ttacacgctgtgattggaagttttctccaaccacctgtcacaatgctgaaattttatcac  c.4072-3121

.         .         .         .         .         .           g.929636
tagagatccatttctttggaagagctgtgggtaggctgcagccagtctcctctgcaatag  c.4072-3061

.         .         .         .         .         .           g.929696
aggctctgattatagccctgaacactgttatctgaaatagtaaattacctgatgtaaatt  c.4072-3001

.         .         .         .         .         .           g.929756
ttagttgaaattttgactgagaacaaaaggaagctatgtttgaattggaatatagggcaa  c.4072-2941

.         .         .         .         .         .           g.929816
agcctcggtcaccaatcttggatacagaattttaatagaaagagattaaaattttctcca  c.4072-2881

.         .         .         .         .         .           g.929876
aataatgtcccacccccattctgacacttttaatacaaaaacagatagatttattgtcca  c.4072-2821

.         .         .         .         .         .           g.929936
aaagatacatctctgagcagtggtgacctttgtttacaatttcttctgtaaatccatttt  c.4072-2761

.         .         .         .         .         .           g.929996
cgtctttgactatttaaagttttctgtttttctcattaaaatttctccttatacttttca  c.4072-2701

.         .         .         .         .         .           g.930056
cccagtcataaataaagctattgggcttcattctaggaactggtattgagcaatgaacag  c.4072-2641

.         .         .         .         .         .           g.930116
gacagccgtaatccttgaactcattagagttgatagtctaaagtaaatgcagaccattaa  c.4072-2581

.         .         .         .         .         .           g.930176
tgggagattaaatatgttatggcacatacaaagtgcaagaaagaacataatgtcatgtga  c.4072-2521

.         .         .         .         .         .           g.930236
gggaatgcataaatagcttaatttagccatcccgtaacatattcatatattaaaacatca  c.4072-2461

.         .         .         .         .         .           g.930296
tgttacgtgctctaacttgatagaatttttacttgtcaaatcaaaaaaatacaaaattca  c.4072-2401

.         .         .         .         .         .           g.930356
aagaacatgcaagaattacctccctgaacttagaaggtgccagaggtagccacttggaag  c.4072-2341

.         .         .         .         .         .           g.930416
agatgtccactacattaagaagataaatgtaaattagccaataaaaggaagtcagaattg  c.4072-2281

.         .         .         .         .         .           g.930476
agattatgccagtaaaagggaacaacatgtttaaggccaagaatcaagagggccacagtg  c.4072-2221

.         .         .         .         .         .           g.930536
taggttgggaaataaaaaataaaatttctgtatagctagagcagggagtaaaagacacca  c.4072-2161

.         .         .         .         .         .           g.930596
gcaggacttatattatgaagggacttttaagccacattaaggataaagcttttggctgcg  c.4072-2101

.         .         .         .         .         .           g.930656
cgcaatgtctcacgcctataatcccagcacttagggaggccgaggtgggtggatcatctt  c.4072-2041

.         .         .         .         .         .           g.930716
aggtcaggagtttgagaccagcctgggcaaattggtgaaaccctgtctctactaaaaata  c.4072-1981

.         .         .         .         .         .           g.930776
caaaaattcgccaggcatggtggcaggtacctgtaatcccagctacttgagaggctgagg  c.4072-1921

.         .         .         .         .         .           g.930836
caggagaatcacttgaaccagggaggcagaggttgcagtgagcagagattgtgccactgc  c.4072-1861

.         .         .         .         .         .           g.930896
actccagtctgggtgacagagagagactccgcctccatctcaaaaaaaaaaaaaaaaaaa  c.4072-1801

.         .         .         .         .         .           g.930956
aaagaatagagcttttatttgaaggacagtaaagaatcactagagaattttagacaggaa  c.4072-1741

.         .         .         .         .         .           g.931016
gccccaattcgttattgagagaacacattgcagctgctttacaggtgggatgtggcagag  c.4072-1681

.         .         .         .         .         .           g.931076
taaaatgccagtgaagaaactgatagcatatttgaggtaagatatagtaatgattttaac  c.4072-1621

.         .         .         .         .         .           g.931136
tagagtaaagacaatggagagagagagaaaagattggaatcaagaactatttagaaggta  c.4072-1561

.         .         .         .         .         .           g.931196
taataaataattagtgattgactgattagatgcaacatgatgaaggacatgatagaggaa  c.4072-1501

.         .         .         .         .         .           g.931256
gtagaaatatctagaattacatctaataaagggaatcattatttgtttttcgctgaaacc  c.4072-1441

.         .         .         .         .         .           g.931316
ggaaaaaatacagagaaggaggaaaagcaagttggggagttgagaagtaggtgagaagag  c.4072-1381

.         .         .         .         .         .           g.931376
tatatgcaaggagttcatgtgtgggagtgttagcttttggtggttgcagaatattcatga  c.4072-1321

.         .         .         .         .         .           g.931436
ggagatgtccaatagggtgagataacatgcaagtatggagatcaaggggagatctggact  c.4072-1261

.         .         .         .         .         .           g.931496
tgagagatgtagagttgagagttgtcagaatgtgaggaggaattgaagttaaggtatggg  c.4072-1201

.         .         .         .         .         .           g.931556
tagaatgagaagaaaggaaagcccaggataaaatcttaatggagtcaaaatttatggtac  c.4072-1141

.         .         .         .         .         .           g.931616
agggagaagtactgggaaagccttccctcttcctgcagcatcactaaacttcctgttctt  c.4072-1081

.         .         .         .         .         .           g.931676
ttgccttagtctagatgcctttaactgtagttttacttgggcaaagctgtgttataggct  c.4072-1021

.         .         .         .         .         .           g.931736
ggcttcactgaagaataatgacatcactaatatttttaaagcttaaaaagtatagtattt  c.4072-961

.         .         .         .         .         .           g.931796
atgtaatatctaatattctatatataatataaaaaccaagatcatcttaaaacctcagtc  c.4072-901

.         .         .         .         .         .           g.931856
atgctctgtgggaaagaaagttatattgtacctgataatcatgcctttacattgtatatt  c.4072-841

.         .         .         .         .         .           g.931916
aaggaaatgtattttaaatgacacataatgaattcccaataagttgcctgccctatttct  c.4072-781

.         .         .         .         .         .           g.931976
tacttttacaactactctgttaaaagtgaacagatccttgaagggagactttccaatctg  c.4072-721

.         .         .         .         .         .           g.932036
tgcagcatggtatttatacttgaacattattgaattatcctaatcatacttatagttaca  c.4072-661

.         .         .         .         .         .           g.932096
atcaagattaattgcagctatattaggattacttattattttttctacttcagcagtaac  c.4072-601

.         .         .         .         .         .           g.932156
ataaacccaattgtacaaacaatttctgtaatccaaattgtgaaagaaagtagggagaaa  c.4072-541

.         .         .         .         .         .           g.932216
aaagatcatgcaaagctggttgaaatagtattcaaaataaatctttaaccagactgttat  c.4072-481

.         .         .         .         .         .           g.932276
ctaaaattctgtttttgacaaggagctgattctgaacagattgtacatgtatctcactgg  c.4072-421

.         .         .         .         .         .           g.932336
tggaagcagattatctgtcttgaattggattgtgatgacgatgaccctattctaagcaaa  c.4072-361

.         .         .   |        .         .         .           g.932396
ccaaatctcttgaactatataat | gagatcaggaggaacattcgacctgagaaagacagat  c.4072-301
                          Dp260 exon 1

.         .         .         .         .         .  |           g.932456
tgcaatgactgagatgattttgctaattttttttccagcctatttccttaat | gtacgtga  c.4072-241
    M  T  E  I  I  L  L  I  F  F  P  A  Y  F  L  N               p.1357+16
    Dp260-1                                            alternative splice site


.         .         .         .         .         .           g.932516
tattgtgattgattttcatgcagagatccctgatcctatagttttgtttgctatttattt  c.4072-181

.         .         .         .         .         .           g.932576
ttctccttcacattttttttctatcaacagagctgaatgagtgccaggaagctgcgaaat  c.4072-121
                                    M  S  A  R  K  L  R  N    p.1358-6
                                    Dp260-2

.         .     |      .         .         .         .           g.932636
ctgtcttacaaaaag | gtgattgtggaagagtctagaatcttcatttattgttcagcagga  c.4072-61
L  S  Y  K  K   |                                                p.1358-1

.         .         .         .         .         .           g.932696
ttacagaaaagctatcaagagtaaacatttaactgatacactcttattccttctttttag  c.4072-1


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center