Cofilin-2 (CFL2) - 976 nt intron 01 reference sequence

Contains alternative promoter/first exon 01b.

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5346
gtaagacgagcgcgctggccgggaggccgcggcgaggcgagaaaagccccccgcacggcc  c.3+60

         .         .         .         .         .         .  g.5406
ccgggagtgaggccgccattttaacctgattttggcctccaaggtgggcgcttctgctct  c.3+120

         .         .         .         .         .         .  g.5466
gcggctccgctgctctccagccgaccggcctgccctccggccgtcaggccctgccctgct  c.3+180

         .         .         .         .         .         .  g.5526
gctctttggattttggggggcggggagggcccgggcgtcggcgcaggttgggggtcgggg  c.3+240

         .         .         .         .         .         .  g.5586
ccgggcgggcgggggcgcgagagggtctgcggactgcagccgctcgcgccgcctttgccc  c.3+300

         .         .         .         .         .         .  g.5646
ttcgcttcctaattttacttaacacgcgaggctttaaaattggtacgtgctgcgaacgct  c.3+360

         .         .         .         .         .         .  g.5706
gtgtgggtcagggtctggacggcctgtaataaaacccttacggggagattaaggaagagg  c.3+420

         .         .         .         .         .         .  g.5766
gaaaacactttttaaaatgctttctcgccgtaaaagcttttacactcgatcagttagttt  c.3+480

          g.5774
tggagtgt  c.3+488

--------------------- middle of intron ---------------------
                                           g.5775             g.5782
                                           c.4-488  ctgcatgt  c.4-481

.         .         .         .         .         .           g.5842
gagctgtgtgtgggccgtgggcggtttggagtttacacttgattctctttccttatgagg  c.4-421

.         .         .         .         .         .           g.5902
aaacgtcagtggctaggatgactttaaagaaaaaaatagtagaagcattaactgaaatcc  c.4-361

.         .         .         .         .         .           g.5962
aaaagtgtttttttaaggccagccgagttgacacaatacagaaggtatttttgctgccac  c.4-301

.         .         .         .         .    /       .           g.6022
tcctgaagctctgacatcacccagtgaaataggaaacatttcag / ggatgggacaacttgt  c.4-241
                                             ^ alternative promoter / exon 1

.         .         .         .         .         .           g.6082
atttgtccctttcgcttccacgtccaaacccctttaagaaggatgaatgggcaggatgag  c.4-181

.         .         .         .         .         .           g.6142
ttagactccttcgctgtatcgtctactgattcttaaaatgtgacaaatctgattggacga  c.4-121
 

.        |   .         .         .         .         .           g.6202
cttacatg | gtacggtgcaatttttgatgtccagactaaagtgagtcttctctaggcaaac  c.4-61
     M   |                                                       p.2-1

.         .         .         .         .         .           g.6262
agtaattttggttaaaaccaaaatacgtgttctgaattactgttctgtgtttattttcag  c.4-1


Powered by LOVDv.2.0-22 Build 22
2004-2009 Leiden University Medical Center