Titin (TTN) - coding DNA reference sequence

(used for mutation description)

(last modified October 11, 2013)


NOTE: based on LRG_391, exon numbering was modified Oct.11, 2013, changing exon 47b to exon 48 and adding +1 to all subsequent exon numbers.

This file was created to facilitate the description of sequence variants in the titin (TTN) gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_011618.3 (LRG_391), covering TTN transcript variant-IC (NM_001267550.1, Inferred Ccomplete).

The titin gene is very large and complex (364 exons) and it generates a range of transcripts and proteins (see Titin homepage). Whether or not all these transcripts exist in nature is, due to the complexity and shear size of the gene/transcripts, difficult to assess. We follow the HGVS recommendations and use a coding DNA reference sequence that includes all exons and still gives a transcript with an open reading frame, i.e. TTN transcript variant-IC (NM_001267550.1). This transcript was recently created by EBI/NCBI and covers all exons for which their is experimental proof. Exon numbering is largely according to Bang et al. (2001) with one exception: exon 123 (located in intron 122) is skipped since there is no experimental evidence for its use. Intron 47 contains an alternative 3'-terminal exon 48.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.28424
                gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgca       c.-181

 .         .         .         .         .         .                g.28484
 tagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctca       c.-121

 .         .         .         .         .         .                g.28544
 ccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagc       c.-61

 .         .         .         .         .       | 02 .             g.31160
 aaccttgggcttagtcccaccctttttaggcactcttgagaaatcag | agtgcctagaaag    c.-1

          .         .         .         .         .         .       g.31220
 ATGACAACTCAAGCACCGACGTTTACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGT       c.60
 M  T  T  Q  A  P  T  F  T  Q  P  L  Q  S  V  V  V  L  E  G         p.20

          .         .         .  | 03      .         .         .    g.33490
 AGTACCGCAACCTTTGAGGCTCACATTAGTG | GTTTTCCAGTTCCTGAGGTGAGCTGGTTT    c.120
 S  T  A  T  F  E  A  H  I  S  G |   F  P  V  P  E  V  S  W  F      p.40

          .         .         .         .         .         .       g.33550
 AGGGATGGCCAGGTGATTTCCACTTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGAT       c.180
 R  D  G  Q  V  I  S  T  S  T  L  P  G  V  Q  I  S  F  S  D         p.60

          .         .         .         .         .         .       g.33610
 GGCCGCGCTAAACTGACGATCCCCGCCGTGACTAAAGCCAACAGTGGACGATATTCCCTG       c.240
 G  R  A  K  L  T  I  P  A  V  T  K  A  N  S  G  R  Y  S  L         p.80

          .         .         .         .         .      | 04  .    g.35125
 AAAGCCACCAATGGATCTGGACAAGCGACTAGTACTGCTGAGCTTCTCGTGAAAG | CTGAG    c.300
 K  A  T  N  G  S  G  Q  A  T  S  T  A  E  L  L  V  K  A |   E      p.100

          .         .         .         .         .         .       g.35185
 ACAGCACCACCCAACTTCGTTCAACGACTGCAGAGCATGACCGTGAGACAAGGAAGCCAA       c.360
 T  A  P  P  N  F  V  Q  R  L  Q  S  M  T  V  R  Q  G  S  Q         p.120

          .         .         .         .         .         .       g.35245
 GTGAGACTCCAAGTGAGAGTGACTGGAATCCCTACACCTGTGGTGAAGTTCTACCGGGAT       c.420
 V  R  L  Q  V  R  V  T  G  I  P  T  P  V  V  K  F  Y  R  D         p.140

          .         .         .         .         .         .       g.35305
 GGAGCCGAAATCCAGAGCTCCCTTGATTTCCAAATTTCACAAGAAGGCGACCTCTACAGC       c.480
 G  A  E  I  Q  S  S  L  D  F  Q  I  S  Q  E  G  D  L  Y  S         p.160

          .         .         .         .         .         .       g.35365
 TTACTGATTGCAGAAGCATACCCTGAGGACTCAGGGACCTATTCAGTAAATGCCACCAAT       c.540
 L  L  I  A  E  A  Y  P  E  D  S  G  T  Y  S  V  N  A  T  N         p.180

          .         .         .         .    | 05    .         .    g.35909
 AGCGTTGGAAGAGCTACTTCGACTGCTGAATTACTGGTTCAAG | GTGAAGAAGAAGTACCT    c.600
 S  V  G  R  A  T  S  T  A  E  L  L  V  Q  G |   E  E  E  V  P      p.200

          .         .         .         .         .         .       g.35969
 GCTAAAAAGACAAAGACAATTGTTTCGACTGCTCAGATCTCAGAATCAAGACAAACCCGA       c.660
 A  K  K  T  K  T  I  V  S  T  A  Q  I  S  E  S  R  Q  T  R         p.220

           | 06        .         .         .         .         .    g.36122
 ATTGAAAAG | AAGATTGAAGCCCACTTTGATGCCAGATCAATTGCAACAGTTGAGATGGTC    c.720
 I  E  K   | K  I  E  A  H  F  D  A  R  S  I  A  T  V  E  M  V      p.240

          .         .         .         .         .         .       g.36182
 ATAGATGGTGCCGCTGGGCAACAGCTGCCACATAAAACACCTCCCAGGATTCCTCCGAAG       c.780
 I  D  G  A  A  G  Q  Q  L  P  H  K  T  P  P  R  I  P  P  K         p.260

          .         .         .         .         .         .       g.36242
 CCAAAGTCAAGATCCCCAACACCACCGTCTATTGCTGCCAAAGCACAGCTGGCTCGGCAG       c.840
 P  K  S  R  S  P  T  P  P  S  I  A  A  K  A  Q  L  A  R  Q         p.280

          .         .         .         .         .         .       g.36302
 CAGTCCCCATCGCCCATAAGACACTCCCCTTCCCCGGTCAGACACGTGCGGGCACCGACC       c.900
 Q  S  P  S  P  I  R  H  S  P  S  P  V  R  H  V  R  A  P  T         p.300

          .     | 07   .         .         .         .         .    g.40596
 CCATCTCCGGTCAG | GTCCGTGTCTCCAGCAGCAAGAATCTCCACATCCCCCATCAGGTCT    c.960
 P  S  P  V  R  |  S  V  S  P  A  A  R  I  S  T  S  P  I  R  S      p.320

          .         .         .         .         .         .       g.40656
 GTTAGGTCTCCATTGCTCATGCGTAAGACTCAGGCATCCACCGTGGCCACAGGTCCTGAA       c.1020
 V  R  S  P  L  L  M  R  K  T  Q  A  S  T  V  A  T  G  P  E         p.340

          .         .         .         .         .         .       g.40716
 GTGCCTCCCCCTTGGAAGCAAGAGGGCTACGTGGCCTCCTCATCTGAGGCTGAGATGAGA       c.1080
 V  P  P  P  W  K  Q  E  G  Y  V  A  S  S  S  E  A  E  M  R         p.360

          .         .         .         .         .         .       g.40776
 GAGACAACGCTGACAACCTCTACTCAGATCAGGACAGAAGAGAGATGGGAAGGGAGATAC       c.1140
 E  T  T  L  T  T  S  T  Q  I  R  T  E  E  R  W  E  G  R  Y         p.380

          .         .         .         .         .         .       g.40836
 GGTGTCCAGGAGCAAGTGACCATCAGTGGTGCTGCGGGTGCTGCCGCCAGTGTGTCGGCC       c.1200
 G  V  Q  E  Q  V  T  I  S  G  A  A  G  A  A  A  S  V  S  A         p.400

          .         .         .         .      | 08  .         .    g.41266
 AGTGCTAGCTACGCAGCAGAGGCTGTTGCCACTGGTGCTAAAGAG | GTGAAACAAGATGCT    c.1260
 S  A  S  Y  A  A  E  A  V  A  T  G  A  K  E   | V  K  Q  D  A      p.420

          .         .         .         .         .         .       g.41326
 GACAAAAGTGCAGCTGTTGCGACTGTTGTTGCTGCCGTTGATATGGCCAGAGTGAGAGAA       c.1320
 D  K  S  A  A  V  A  T  V  V  A  A  V  D  M  A  R  V  R  E         p.440

          .         .         .         .         .         .       g.41386
 CCAGTGATCAGCGCTGTAGAGCAGACTGCTCAGAGGACAACCACGACTGCTGTGCACATC       c.1380
 P  V  I  S  A  V  E  Q  T  A  Q  R  T  T  T  T  A  V  H  I         p.460

          .         | 09         .         .         .         .    g.42303
 CAACCTGCTCAAGAACAG | GTAAGAAAGGAAGCGGAGAAGACTGCTGTAACTAAGGTAGTA    c.1440
 Q  P  A  Q  E  Q   | V  R  K  E  A  E  K  T  A  V  T  K  V  V      p.480

          .         .         .         .         .         .       g.42363
 GTGGCCGCCGATAAAGCCAAGGAACAAGAATTAAAATCAAGAACCAAAGAAGTAATTACC       c.1500
 V  A  A  D  K  A  K  E  Q  E  L  K  S  R  T  K  E  V  I  T         p.500

          .         .         .       | 10 .         .         .    g.43629
 ACAAAGCAAGAGCAGATGCACGTAACTCATGAGCAG | ATAAGAAAAGAAACTGAAAAAACA    c.1560
 T  K  Q  E  Q  M  H  V  T  H  E  Q   | I  R  K  E  T  E  K  T      p.520

          .         .         .         .         .         .       g.43689
 TTTGTACCAAAGGTAGTAATTTCCGCAGCTAAAGCCAAAGAACAAGAAACTAGAATTTCT       c.1620
 F  V  P  K  V  V  I  S  A  A  K  A  K  E  Q  E  T  R  I  S         p.540

          .         .         .         .   | 11     .         .    g.44975
 GAAGAAATTACTAAGAAACAGAAACAAGTAACTCAAGAAGCA | ATAAGACAGGAAACTGAG    c.1680
 E  E  I  T  K  K  Q  K  Q  V  T  Q  E  A   | I  R  Q  E  T  E      p.560

          .         .         .         .         .         .       g.45035
 ATAACTGCTGCATCCATGGTGGTAGTTGCCACTGCAAAGTCCACAAAACTAGAAACAGTC       c.1740
 I  T  A  A  S  M  V  V  V  A  T  A  K  S  T  K  L  E  T  V         p.580

          .         .         .         .         .         .       g.45095
 CCGGGAGCTCAAGAAGAAACTACCACACAACAAGATCAAATGCACCTAAGTTATGAAAAG       c.1800
 P  G  A  Q  E  E  T  T  T  Q  Q  D  Q  M  H  L  S  Y  E  K         p.600

  | 12       .         .         .         .         .         .    g.45747
  | ATAATGAAGGAAACTAGGAAAACAGTTGTACCTAAAGTCATAGTTGCCACACCCAAAGTC    c.1860
  | I  M  K  E  T  R  K  T  V  V  P  K  V  I  V  A  T  P  K  V      p.620

          .         .         .         .         .         .       g.45807
 AAAGAACAAGATTTAGTATCAAGAGGTAGAGAAGGCATTACTACCAAAAGAGAACAAGTG       c.1920
 K  E  Q  D  L  V  S  R  G  R  E  G  I  T  T  K  R  E  Q  V         p.640

          .         | 13         .         .         .         .    g.46347
 CAAATAACTCAGGAGAAG | ATGAGAAAGGAAGCCGAGAAAACTGCCTTGTCTACAATAGCA    c.1980
 Q  I  T  Q  E  K   | M  R  K  E  A  E  K  T  A  L  S  T  I  A      p.660

          .         .         .         .         .         .       g.46407
 GTTGCTACTGCTAAAGCCAAAGAACAAGAAACAATACTGAGAACTAGAGAAACTATGGCT       c.2040
 V  A  T  A  K  A  K  E  Q  E  T  I  L  R  T  R  E  T  M  A         p.680

          .         .         .       | 14 .         .         .    g.49685
 ACTAGACAAGAACAAATCCAAGTTACCCATGGAAAG | GTGGACGTTGGAAAAAAGGCTGAA    c.2100
 T  R  Q  E  Q  I  Q  V  T  H  G  K   | V  D  V  G  K  K  A  E      p.700

          .         .         .         .         .         .       g.49745
 GCTGTAGCAACAGTTGTTGCTGCAGTAGACCAGGCCCGAGTCAGAGAGCCCAGAGAGCCT       c.2160
 A  V  A  T  V  V  A  A  V  D  Q  A  R  V  R  E  P  R  E  P         p.720

          .         .         .         .         .         .       g.49805
 GGGCATCTTGAAGAATCCTATGCTCAGCAGACCACTTTGGAGTACGGATATAAGGAACGC       c.2220
 G  H  L  E  E  S  Y  A  Q  Q  T  T  L  E  Y  G  Y  K  E  R         p.740

          .         .         .         .         .         .       g.49865
 ATTTCCGCCGCAAAGGTAGCTGAGCCTCCCCAACGTCCAGCCTCAGAACCCCACGTTGTC       c.2280
 I  S  A  A  K  V  A  E  P  P  Q  R  P  A  S  E  P  H  V  V         p.760

          .         .         .         .         .         .       g.49925
 CCTAAAGCAGTCAAGCCTAGAGTAATCCAGGCTCCTTCTGAGACTCATATCAAAACTACT       c.2340
 P  K  A  V  K  P  R  V  I  Q  A  P  S  E  T  H  I  K  T  T         p.780

          .         .         . | 15       .         .         .    g.50090
 GATCAAAAGGGAATGCACATATCATCACAG | ATCAAGAAAACTACAGATCTAACAACGGAA    c.2400
 D  Q  K  G  M  H  I  S  S  Q   | I  K  K  T  T  D  L  T  T  E      p.800

          .         .         .         .         .         .       g.50150
 AGATTAGTCCATGTGGATAAACGCCCCCGCACAGCTAGCCCTCACTTTACTGTTTCAAAA       c.2460
 R  L  V  H  V  D  K  R  P  R  T  A  S  P  H  F  T  V  S  K         p.820

          .         .         .    | 16    .         .         .    g.51478
 ATTTCTGTTCCTAAGACAGAACATGGATATGAG | GCATCAATAGCCGGTAGTGCTATTGCC    c.2520
 I  S  V  P  K  T  E  H  G  Y  E   | A  S  I  A  G  S  A  I  A      p.840

          .         .         .         .         .         .       g.51538
 ACATTACAAAAAGAGTTGTCAGCCACATCTTCTGCTCAGAAGATCACCAAATCGGTGAAG       c.2580
 T  L  Q  K  E  L  S  A  T  S  S  A  Q  K  I  T  K  S  V  K         p.860

          .         .         .         .         .         .       g.51598
 GCTCCTACTGTGAAGCCCAGTGAGACTAGAGTAAGGGCAGAGCCCACACCCTTGCCACAG       c.2640
 A  P  T  V  K  P  S  E  T  R  V  R  A  E  P  T  P  L  P  Q         p.880

          .         .         .         .         .         .       g.51658
 TTCCCCTTCGCTGACACACCAGATACTTACAAGAGTGAAGCTGGCGTTGAGGTGAAAAAG       c.2700
 F  P  F  A  D  T  P  D  T  Y  K  S  E  A  G  V  E  V  K  K         p.900

          .         .         .         .         .         .       g.51718
 GAAGTAGGGGTGAGCATCACTGGCACCACCGTCCGTGAAGAGCGCTTTGAAGTACTGCAC       c.2760
 E  V  G  V  S  I  T  G  T  T  V  R  E  E  R  F  E  V  L  H         p.920

          .      | 17  .         .         .         .         .    g.52062
 GGACGCGAAGCCAAG | GTAACAGAAACAGCAAGAGTACCAGCACCTGTTGAAATTCCTGTT    c.2820
 G  R  E  A  K   | V  T  E  T  A  R  V  P  A  P  V  E  I  P  V      p.940

          .         .  | 18      .         .         .         .    g.52777
 ACTCCACCAACTTTGGTCTCG | GGCTTAAAAAATGTGACTGTCATAGAAGGTGAATCTGTC    c.2880
 T  P  P  T  L  V  S   | G  L  K  N  V  T  V  I  E  G  E  S  V      p.960

          .         .         .         .         .         .       g.52837
 ACCTTGGAGTGCCACATCTCTGGATACCCATCCCCGACAGTGACATGGTACAGGGAAGAC       c.2940
 T  L  E  C  H  I  S  G  Y  P  S  P  T  V  T  W  Y  R  E  D         p.980

          .         .         .         .         .         .       g.52897
 TACCAAATCGAAAGTTCCATTGACTTCCAGATAACCTTCCAGAGTGGAATTGCTCGTCTT       c.3000
 Y  Q  I  E  S  S  I  D  F  Q  I  T  F  Q  S  G  I  A  R  L         p.1000

          .         .         .         .         .         .       g.52957
 ATGATTCGCGAAGCATTTGCGGAAGACAGCGGGCGATTTACTTGCAGTGCTGTAAATGAG       c.3060
 M  I  R  E  A  F  A  E  D  S  G  R  F  T  C  S  A  V  N  E         p.1020

          .         .         .         . | 19       .         .    g.53220
 GCTGGAACCGTCAGCACATCCTGCTATCTGGCTGTGCAGG | TGTCAGAAGAATTTGAAAAG    c.3120
 A  G  T  V  S  T  S  C  Y  L  A  V  Q  V |   S  E  E  F  E  K      p.1040

          .         .         .         .     | 20   .         .    g.53391
 GAAACCACAGCCGTGACTGAGAAATTTACTACAGAAGAGAAACG | CTTTGTTGAGTCAAGA    c.3180
 E  T  T  A  V  T  E  K  F  T  T  E  E  K  R  |  F  V  E  S  R      p.1060

          .         .         .         .         .         .       g.53451
 GATGTGGTTATGACTGATACTAGCCTCACAGAGGAACAAGCAGGGCCTGGAGAACCTGCC       c.3240
 D  V  V  M  T  D  T  S  L  T  E  E  Q  A  G  P  G  E  P  A         p.1080

          .         .         .         .         .         .       g.53511
 GCGCCTTACTTTATTACAAAACCAGTGGTCCAGAAACTGGTGGAAGGTGGGAGCGTGGTG       c.3300
 A  P  Y  F  I  T  K  P  V  V  Q  K  L  V  E  G  G  S  V  V         p.1100

          .         .         .         .         .         .       g.53571
 TTTGGATGCCAAGTTGGCGGCAACCCAAAGCCCCATGTATACTGGAAAAAATCTGGTGTT       c.3360
 F  G  C  Q  V  G  G  N  P  K  P  H  V  Y  W  K  K  S  G  V         p.1120

          .         . | 21       .         .         .         .    g.54579
 CCTCTAACCACTGGATACAG | ATACAAAGTGAGTTACAACAAACAAACCGGTGAATGCAAG    c.3420
 P  L  T  T  G  Y  R  |  Y  K  V  S  Y  N  K  Q  T  G  E  C  K      p.1140

          .         .         .         .         .         .       g.54639
 CTGGTGATTTCTATGACTTTTGCTGATGATGCTGGAGAATACACTATTGTTGTTCGCAAT       c.3480
 L  V  I  S  M  T  F  A  D  D  A  G  E  Y  T  I  V  V  R  N         p.1160

          .         .         .         .    | 22    .         .    g.55614
 AAGCATGGAGAAACTTCTGCATCTGCTTCCTTGCTTGAAGAAG | CTGATTATGAGTTACTG    c.3540
 K  H  G  E  T  S  A  S  A  S  L  L  E  E  A |   D  Y  E  L  L      p.1180

          .         .         .         .         .         .       g.55674
 ATGAAGTCCCAGCAAGAAATGCTTTATCAGACACAAGTGACTGCATTTGTTCAAGAACCT       c.3600
 M  K  S  Q  Q  E  M  L  Y  Q  T  Q  V  T  A  F  V  Q  E  P         p.1200

          .         .         .         .         .         .       g.55734
 AAAGTTGGAGAAACAGCACCTGGATTTGTATACTCTGAGTATGAAAAAGAGTATGAAAAA       c.3660
 K  V  G  E  T  A  P  G  F  V  Y  S  E  Y  E  K  E  Y  E  K         p.1220

          .         .         .         .         .         .       g.55794
 GAACAAGCCTTAATTAGGAAGAAAATGGCCAAAGATACTGTAGTGGTCAGAACTTATGTA       c.3720
 E  Q  A  L  I  R  K  K  M  A  K  D  T  V  V  V  R  T  Y  V         p.1240

           | 23        .         .         .         .         .    g.56391
 GAAGATCAG | GAATTCCATATTTCTTCCTTTGAAGAGAGACTTATTAAAGAAATTGAATAT    c.3780
 E  D  Q   | E  F  H  I  S  S  F  E  E  R  L  I  K  E  I  E  Y      p.1260

          .         .         .         .         .         .       g.56451
 AGAATAATAAAGACTACATTAGAAGAACTTCTTGAAGAAGATGGAGAAGAAAAGATGGCA       c.3840
 R  I  I  K  T  T  L  E  E  L  L  E  E  D  G  E  E  K  M  A         p.1280

          .         .         .         .         .         .       g.56511
 GTTGACATTTCTGAATCTGAAGCTGTTGAATCAGGATTTGATTCAAGAATCAAGAATTAT       c.3900
 V  D  I  S  E  S  E  A  V  E  S  G  F  D  S  R  I  K  N  Y         p.1300

          .         .         .         .         .         .       g.56571
 AGAATTCTTGAGGGGATGGGTGTCACTTTTCATTGCAAGATGTCTGGATATCCATTACCA       c.3960
 R  I  L  E  G  M  G  V  T  F  H  C  K  M  S  G  Y  P  L  P         p.1320

     | 24    .         .         .         .         .         .    g.56741
 AAG | ATTGCTTGGTACAAAGATGGCAAGCGCATCAAACATGGAGAAAGATACCAAATGGAC    c.4020
 K   | I  A  W  Y  K  D  G  K  R  I  K  H  G  E  R  Y  Q  M  D      p.1340

          .         .         .         .         .         .       g.56801
 TTTCTACAAGATGGCAGAGCTAGTCTGCGTATACCTGTTGTTCTTCCAGAAGATGAAGGA       c.4080
 F  L  Q  D  G  R  A  S  L  R  I  P  V  V  L  P  E  D  E  G         p.1360

          .         .         .         .         .         .       g.56861
 ATCTACACTGCATTTGCCAGCAATATTAAAGGAAATGCAATTTGCTCAGGGAAATTGTAT       c.4140
 I  Y  T  A  F  A  S  N  I  K  G  N  A  I  C  S  G  K  L  Y         p.1380

          .         .         .         .         .         .       g.56921
 GTGGAGCCTGCTGCACCACTTGGAGCTCCGACTTACATTCCCACACTAGAGCCAGTGAGC       c.4200
 V  E  P  A  A  P  L  G  A  P  T  Y  I  P  T  L  E  P  V  S         p.1400

          | 25         .         .         .         .         .    g.57879
 AGAATCAG | ATCTCTCTCTCCACGTTCAGTGAGCAGGTCTCCTATACGCATGTCTCCTGCA    c.4260
 R  I  R  |  S  L  S  P  R  S  V  S  R  S  P  I  R  M  S  P  A      p.1420

          .         .         .         .         .         .       g.57939
 CGGATGTCACCTGCAAGGATGTCTCCTGCACGGATGTCCCCTGCAAGAATGTCCCCTGGA       c.4320
 R  M  S  P  A  R  M  S  P  A  R  M  S  P  A  R  M  S  P  G         p.1440

          .         .         .         .         .         .       g.57999
 CGTAGGCTGGAGGAGACAGATGAGTCACAACTTGAGAGACTATATAAACCAGTCTTTGTG       c.4380
 R  R  L  E  E  T  D  E  S  Q  L  E  R  L  Y  K  P  V  F  V         p.1460

          .         .         .         .         .         .       g.58059
 TTAAAACCTGTTTCTTTCAAATGTTTAGAAGGGCAAACTGCCAGATTTGACTTAAAGGTT       c.4440
 L  K  P  V  S  F  K  C  L  E  G  Q  T  A  R  F  D  L  K  V         p.1480

          .         .         .         . | 26       .         .    g.58238
 GTTGGTAGACCTATGCCAGAGACGTTCTGGTTTCATGATG | GCCAGCAAATTGTCAATGAC    c.4500
 V  G  R  P  M  P  E  T  F  W  F  H  D  G |   Q  Q  I  V  N  D      p.1500

          .         .         .         .         .         .       g.58298
 TATACCCATAAAGTAGTCATTAAAGAAGATGGTACTCAATCACTAATTATTGTCCCTGCC       c.4560
 Y  T  H  K  V  V  I  K  E  D  G  T  Q  S  L  I  I  V  P  A         p.1520

          .         .         .         .         .         .       g.58358
 ACACCCAGTGATTCTGGGGAATGGACTGTGGTTGCCCAAAACAGGGCAGGCAGATCTTCA       c.4620
 T  P  S  D  S  G  E  W  T  V  V  A  Q  N  R  A  G  R  S  S         p.1540

          .         .      | 27  .         .         .         .    g.58520
 ATTTCAGTGATTTTAACTGTGGAAG | CTGTGGAACATCAGGTAAAACCGATGTTTGTAGAA    c.4680
 I  S  V  I  L  T  V  E  A |   V  E  H  Q  V  K  P  M  F  V  E      p.1560

          .         .         .         .         .         .       g.58580
 AAACTGAAAAATGTCAATATAAAGGAAGGTTCCCGACTTGAAATGAAAGTCAGAGCTACG       c.4740
 K  L  K  N  V  N  I  K  E  G  S  R  L  E  M  K  V  R  A  T         p.1580

          .         .         .         .         .         .       g.58640
 GGTAACCCCAACCCTGACATTGTATGGTTGAAAAACAGTGACATCATTGTGCCTCATAAA       c.4800
 G  N  P  N  P  D  I  V  W  L  K  N  S  D  I  I  V  P  H  K         p.1600

          .     | 28   .         .         .         .         .    g.58799
 TATCCCAAAATCAG | AATTGAAGGAACCAAGGGAGAAGCTGCCCTTAAAATCGATTCCACT    c.4860
 Y  P  K  I  R  |  I  E  G  T  K  G  E  A  A  L  K  I  D  S  T      p.1620

          .         .         .         .         .         .       g.58859
 GTCAGCCAAGATTCTGCCTGGTATACTGCGACTGCTATTAATAAAGCTGGCAGAGACACT       c.4920
 V  S  Q  D  S  A  W  Y  T  A  T  A  I  N  K  A  G  R  D  T         p.1640

          .         .         .         .         .         .       g.58919
 ACAAGATGCAAAGTAAATGTTGAAGTTGAGTTTGCAGAGCCTGAGCCAGAGAGAAAGTTA       c.4980
 T  R  C  K  V  N  V  E  V  E  F  A  E  P  E  P  E  R  K  L         p.1660

          .         .         .         .         .         .       g.58979
 ATCATCCCACGGGGGACATATAGAGCAAAGGAGATTGCAGCCCCAGAACTGGAGCCCCTC       c.5040
 I  I  P  R  G  T  Y  R  A  K  E  I  A  A  P  E  L  E  P  L         p.1680

          .         .         .         .         .         .       g.59039
 CATTTGCGATATGGCCAAGAGCAATGGGAAGAAGGTGATCTCTATGACAAAGAGAAACAA       c.5100
 H  L  R  Y  G  Q  E  Q  W  E  E  G  D  L  Y  D  K  E  K  Q         p.1700

          .         .         .         .         .         .       g.59099
 CAGAAACCATTTTTCAAGAAAAAACTCACTTCCTTAAGACTTAAGCGCTTTGGGCCTGCC       c.5160
 Q  K  P  F  F  K  K  K  L  T  S  L  R  L  K  R  F  G  P  A         p.1720

          .         .         .         .         .         .       g.59159
 CACTTTGAATGCAGGCTAACACCCATTGGTGACCCAACGATGGTGGTGGAGTGGCTCCAT       c.5220
 H  F  E  C  R  L  T  P  I  G  D  P  T  M  V  V  E  W  L  H         p.1740

          .         .         .         .         .         .       g.59219
 GATGGAAAGCCACTTGAAGCAGCCAACAGGCTCCGTATGATCAATGAATTTGGGTACTGC       c.5280
 D  G  K  P  L  E  A  A  N  R  L  R  M  I  N  E  F  G  Y  C         p.1760

          .         .         .         .         .         .       g.59279
 AGCCTTGATTATGGCGTTGCATATTCTAGAGACAGTGGTATCATTACTTGCAGAGCCACT       c.5340
 S  L  D  Y  G  V  A  Y  S  R  D  S  G  I  I  T  C  R  A  T         p.1780

          .         .         .         .         .         .       g.59339
 AACAAATATGGAACAGATCACACATCTGCTACCCTTATTGTTAAAGATGAGAAAAGTCTT       c.5400
 N  K  Y  G  T  D  H  T  S  A  T  L  I  V  K  D  E  K  S  L         p.1800

          .         .         .         .         .         .       g.59399
 GTGGAAGAATCCCAATTGCCTGAGGGGAGGAAAGGCTTACAGAGAATTGAAGAATTAGAG       c.5460
 V  E  E  S  Q  L  P  E  G  R  K  G  L  Q  R  I  E  E  L  E         p.1820

          .         .         .         .         .         .       g.59459
 AGAATGGCTCATGAAGGTGCACTTACAGGTGTAACAACAGATCAGAAAGAAAAGCAAAAG       c.5520
 R  M  A  H  E  G  A  L  T  G  V  T  T  D  Q  K  E  K  Q  K         p.1840

          .         .         .         .         .         .       g.59519
 CCAGACATTGTCTTGTACCCAGAGCCAGTTAGAGTACTTGAAGGGGAGACTGCAAGGTTC       c.5580
 P  D  I  V  L  Y  P  E  P  V  R  V  L  E  G  E  T  A  R  F         p.1860

          .         .         .         .         .         .       g.59579
 CGCTGCAGGGTAACAGGCTACCCTCAGCCCAAAGTCAACTGGTACCTCAATGGACAGCTC       c.5640
 R  C  R  V  T  G  Y  P  Q  P  K  V  N  W  Y  L  N  G  Q  L         p.1880

          .         .         .         .         .         .       g.59639
 ATCCGCAAAAGCAAAAGGTTCAGAGTTCGCTATGATGGTATCCATTACCTGGACATCGTG       c.5700
 I  R  K  S  K  R  F  R  V  R  Y  D  G  I  H  Y  L  D  I  V         p.1900

          .         .         .         .         .         .       g.59699
 GACTGCAAATCATATGACACAGGTGAAGTGAAGGTCACCGCGGAAAATCCTGAAGGTGTG       c.5760
 D  C  K  S  Y  D  T  G  E  V  K  V  T  A  E  N  P  E  G  V         p.1920

          .         .         .         .         .         .       g.59759
 ATAGAGCATAAAGTGAAGCTTGAGATTCAACAGAGGGAAGATTTTAGGTCTGTCCTTAGG       c.5820
 I  E  H  K  V  K  L  E  I  Q  Q  R  E  D  F  R  S  V  L  R         p.1940

          .         .         .         .         .         .       g.59819
 AGAGCTCCTGAACCAAGGCCTGAGTTTCACGTACATGAACCAGGAAAGCTTCAGTTTGAA       c.5880
 R  A  P  E  P  R  P  E  F  H  V  H  E  P  G  K  L  Q  F  E         p.1960

          .         .         .         .         .         .       g.59879
 GTACAAAAAGTGGATAGACCTGTTGACACCACTGAAACCAAAGAAGTTGTGAAGTTGAAA       c.5940
 V  Q  K  V  D  R  P  V  D  T  T  E  T  K  E  V  V  K  L  K         p.1980

          .         .         .         .         .         .       g.59939
 AGGGCTGAAAGAATTACCCATGAAAAAGTGCCTGAAGAGTCGGAAGAGCTGCGCAGTAAA       c.6000
 R  A  E  R  I  T  H  E  K  V  P  E  E  S  E  E  L  R  S  K         p.2000

          .         .         .         .         .         .       g.59999
 TTCAAGCGCAGAACAGAAGAGGGCTATTATGAAGCCATTACCGCTGTGGAGCTCAAGTCT       c.6060
 F  K  R  R  T  E  E  G  Y  Y  E  A  I  T  A  V  E  L  K  S         p.2020

          .         .         .         .         .         .       g.60059
 CGAAAGAAGGATGAATCCTATGAGGAACTCCTCAGGAAGACAAAAGATGAACTTCTCCAC       c.6120
 R  K  K  D  E  S  Y  E  E  L  L  R  K  T  K  D  E  L  L  H         p.2040

          .         .         .         .         .         .       g.60119
 TGGACCAAAGAGTTAACTGAAGAGGAAAAGAAAGCTCTTGCCGAAGAAGGCAAAATCACG       c.6180
 W  T  K  E  L  T  E  E  E  K  K  A  L  A  E  E  G  K  I  T         p.2060

          .         .         .         .         .         .       g.60179
 ATTCCAACTTTTAAACCTGACAAGATTGAACTAAGTCCTAGTATGGAGGCTCCAAAAATC       c.6240
 I  P  T  F  K  P  D  K  I  E  L  S  P  S  M  E  A  P  K  I         p.2080

          .         .         .         .         .         .       g.60239
 TTCGAAAGAATCCAGAGCCAAACAGTGGGCCAAGGATCTGATGCACACTTCCGGGTCAGA       c.6300
 F  E  R  I  Q  S  Q  T  V  G  Q  G  S  D  A  H  F  R  V  R         p.2100

          .         .         .         .         .         .       g.60299
 GTCGTGGGGAAACCAGACCCCGAATGTGAATGGTACAAAAATGGTGTCAAAATTGAACGG       c.6360
 V  V  G  K  P  D  P  E  C  E  W  Y  K  N  G  V  K  I  E  R         p.2120

          .         .         .         .         .         .       g.60359
 TCTGACCGGATCTACTGGTACTGGCCCGAAGACAATGTTTGTGAATTGGTCATAAGAGAT       c.6420
 S  D  R  I  Y  W  Y  W  P  E  D  N  V  C  E  L  V  I  R  D         p.2140

          .         .         .         .         .         .       g.60419
 GTGACTGCTGAGGACTCTGCCAGCATCATGGTAAAAGCCATCAACATAGCTGGAGAAACC       c.6480
 V  T  A  E  D  S  A  S  I  M  V  K  A  I  N  I  A  G  E  T         p.2160

          .         .         | 29         .         .         .    g.60632
 TCCAGTCACGCATTCTTACTTGTCCAAG | CCAAGCAATTGATCACTTTCACACAGGAATTA    c.6540
 S  S  H  A  F  L  L  V  Q  A |   K  Q  L  I  T  F  T  Q  E  L      p.2180

          .         .         .         .         .         .       g.60692
 CAAGATGTTGTTGCTAAGGAAAAAGACACTATGGCAACCTTTGAATGTGAAACTTCAGAA       c.6600
 Q  D  V  V  A  K  E  K  D  T  M  A  T  F  E  C  E  T  S  E         p.2200

          .         .         .         .         .         .       g.60752
 CCATTTGTCAAAGTGAAATGGTATAAAGATGGTATGGAGGTTCATGAGGGAGATAAATAC       c.6660
 P  F  V  K  V  K  W  Y  K  D  G  M  E  V  H  E  G  D  K  Y         p.2220

          .         .         .         .         .         .       g.60812
 AGGATGCACTCTGACAGAAAGGTTCACTTCCTCTCCATACTGACCATTGATACGTCTGAT       c.6720
 R  M  H  S  D  R  K  V  H  F  L  S  I  L  T  I  D  T  S  D         p.2240

          .         .         .         .         .         .       g.60872
 GCTGAAGATTACAGCTGTGTACTTGTGGAAGATGAAAATGTCAAAACGACTGCTAAACTT       c.6780
 A  E  D  Y  S  C  V  L  V  E  D  E  N  V  K  T  T  A  K  L         p.2260

          . | 30       .         .         .         .         .    g.61379
 ATTGTTGAAG | GTGCAGTTGTTGAGTTTGTGAAAGAACTTCAGGACATAGAAGTTCCAGAA    c.6840
 I  V  E  G |   A  V  V  E  F  V  K  E  L  Q  D  I  E  V  P  E      p.2280

          .         .         .         .         .         .       g.61439
 TCATATTCAGGAGAATTAGAGTGCATTGTATCCCCAGAAAATATAGAAGGAAAATGGTAT       c.6900
 S  Y  S  G  E  L  E  C  I  V  S  P  E  N  I  E  G  K  W  Y         p.2300

          .         .         .         .         .         .       g.61499
 CATAATGATGTGGAGCTTAAATCCAATGGCAAATATACAATTACATCTCGTCGTGGACGT       c.6960
 H  N  D  V  E  L  K  S  N  G  K  Y  T  I  T  S  R  R  G  R         p.2320

          .         .         .         .         .         .       g.61559
 CAGAACCTCACGGTCAAGGATGTAACCAAGGAGGACCAGGGAGAATACAGCTTTGTCATC       c.7020
 Q  N  L  T  V  K  D  V  T  K  E  D  Q  G  E  Y  S  F  V  I         p.2340

          .         .         .        | 31.         .         .    g.61715
 GACGGGAAAAAGACAACCTGTAAATTAAAGATGAAAC | CCCGCCCCATTGCTATCCTACAA    c.7080
 D  G  K  K  T  T  C  K  L  K  M  K  P |   R  P  I  A  I  L  Q      p.2360

          .         .         .         .         .         .       g.61775
 GGACTTAGTGACCAAAAAGTCTGTGAGGGTGACATTGTTCAGCTTGAAGTTAAAGTCTCC       c.7140
 G  L  S  D  Q  K  V  C  E  G  D  I  V  Q  L  E  V  K  V  S         p.2380

          .         .         .         .         .         .       g.61835
 TTGGAAAGTGTGGAAGGCGTCTGGATGAAAGACGGCCAAGAAGTGCAGCCCAGTGACAGG       c.7200
 L  E  S  V  E  G  V  W  M  K  D  G  Q  E  V  Q  P  S  D  R         p.2400

          .         .         .         .         .         .       g.61895
 GTTCACATTGTGATAGACAAACAATCTCATATGCTGCTCATTGAAGACATGACTAAGGAA       c.7260
 V  H  I  V  I  D  K  Q  S  H  M  L  L  I  E  D  M  T  K  E         p.2420

          .         .         .         .         .         .       g.61955
 GATGCTGGAAATTACTCTTTCACCATTCCAGCCCTTGGCCTCTCCACCAGTGGGCGTGTC       c.7320
 D  A  G  N  Y  S  F  T  I  P  A  L  G  L  S  T  S  G  R  V         p.2440

          . | 32       .         .         .         .         .    g.62127
 TCTGTCTATA | GTGTGGACGTGATAACACCTCTAAAAGATGTTAATGTGATTGAAGGCACC    c.7380
 S  V  Y  S |   V  D  V  I  T  P  L  K  D  V  N  V  I  E  G  T      p.2460

          .         .         .         .         .         .       g.62187
 AAGGCTGTGCTTGAATGTAAGGTGTCAGTCCCTGATGTGACTTCTGTTAAGTGGTACTTA       c.7440
 K  A  V  L  E  C  K  V  S  V  P  D  V  T  S  V  K  W  Y  L         p.2480

          .         .         .         .         .         .       g.62247
 AATGATGAACAAATCAAGCCTGATGACCGTGTACAGGCCATTGTGAAAGGTACTAAACAG       c.7500
 N  D  E  Q  I  K  P  D  D  R  V  Q  A  I  V  K  G  T  K  Q         p.2500

          .         .         .         .         .         .       g.62307
 CGACTAGTCATTAACCGAACTCATGCTTCAGACGAAGGACCTTACAAGCTGATAGTTGGC       c.7560
 R  L  V  I  N  R  T  H  A  S  D  E  G  P  Y  K  L  I  V  G         p.2520

          .         .         .     | 33   .         .         .    g.62459
 AGAGTTGAAACCAACTGTAATCTCTCTGTAGAAA | AAATTAAAATTATCAGAGGTCTTCGT    c.7620
 R  V  E  T  N  C  N  L  S  V  E  K |   I  K  I  I  R  G  L  R      p.2540

          .         .         .         .         .         .       g.62519
 GACCTTACCTGTACAGAAACTCAAAATGTGGTGTTTGAGGTTGAGCTGTCCCACTCTGGA       c.7680
 D  L  T  C  T  E  T  Q  N  V  V  F  E  V  E  L  S  H  S  G         p.2560

          .         .         .         .         .         .       g.62579
 ATTGATGTCCTGTGGAATTTTAAGGACAAGGAAATCAAGCCCAGTTCTAAATATAAAATT       c.7740
 I  D  V  L  W  N  F  K  D  K  E  I  K  P  S  S  K  Y  K  I         p.2580

          .         .         .         .         .         .       g.62639
 GAAGCACATGGAAAAATATATAAATTGACAGTTCTAAATATGATGAAAGATGATGAAGGA       c.7800
 E  A  H  G  K  I  Y  K  L  T  V  L  N  M  M  K  D  D  E  G         p.2600

          .         .         .         .         .      | 34  .    g.64336
 AAATACACATTTTACGCGGGAGAAAATATGACATCTGGAAAACTTACTGTGGCAG | GTGGG    c.7860
 K  Y  T  F  Y  A  G  E  N  M  T  S  G  K  L  T  V  A  G |   G      p.2620

          .         .         .         .         .         .       g.64396
 GCCATCTCCAAGCCACTCACAGATCAGACCGTAGCTGAATCCCAGGAAGCTGTGTTTGAA       c.7920
 A  I  S  K  P  L  T  D  Q  T  V  A  E  S  Q  E  A  V  F  E         p.2640

          .         .         .         .         .         .       g.64456
 TGTGAAGTTGCCAACCCAGATTCCAAAGGCGAATGGTTGAGGGATGGCAAACACCTACCA       c.7980
 C  E  V  A  N  P  D  S  K  G  E  W  L  R  D  G  K  H  L  P         p.2660

          .         .         .         .         .         .       g.64516
 CTGACTAACAACATCAGAAGTGAGTCTGATGGCCACAAAAGGAGACTTATCATTGCTGCC       c.8040
 L  T  N  N  I  R  S  E  S  D  G  H  K  R  R  L  I  I  A  A         p.2680

          .         .         .         .         .         .       g.64576
 ACCAAATTAGATGACATTGGAGAATATACCTACAAGGTGGCCACCTCCAAAACATCTGCC       c.8100
 T  K  L  D  D  I  G  E  Y  T  Y  K  V  A  T  S  K  T  S  A         p.2700

          .       | 35 .         .         .         .         .    g.65171
 AAACTCAAAGTTGAAG | CTGTCAAAATTAAGAAGACTCTGAAGAACCTCACAGTGACAGAA    c.8160
 K  L  K  V  E  A |   V  K  I  K  K  T  L  K  N  L  T  V  T  E      p.2720

          .         .         .         .         .         .       g.65231
 ACACAGGATGCTGTTTTCACTGTCGAGCTTACACACCCTAATGTCAAAGGTGTCCAGTGG       c.8220
 T  Q  D  A  V  F  T  V  E  L  T  H  P  N  V  K  G  V  Q  W         p.2740

          .         .         .         .         .         .       g.65291
 ATCAAAAATGGAGTTGTGCTGGAATCCAATGAAAAGTATGCTATCTCTGTCAAAGGAACA       c.8280
 I  K  N  G  V  V  L  E  S  N  E  K  Y  A  I  S  V  K  G  T         p.2760

          .         .         .         .         .         .       g.65351
 ATTTACTCTCTGAGGATTAAAAACTGTGCCATCGTGGATGAGTCTGTTTATGGCTTCAGG       c.8340
 I  Y  S  L  R  I  K  N  C  A  I  V  D  E  S  V  Y  G  F  R         p.2780

          .         .         .         . | 36       .         .    g.65502
 CTTGGAAGGCTTGGAGCCAGTGCCAGACTGCACGTGGAGA | CTGTCAAGATCATTAAAAAG    c.8400
 L  G  R  L  G  A  S  A  R  L  H  V  E  T |   V  K  I  I  K  K      p.2800

          .         .         .         .         .         .       g.65562
 CCAAAGGATGTGACAGCCTTGGAAAATGCCACTGTTGCCTTTGAAGTTAGTGTTTCCCAT       c.8460
 P  K  D  V  T  A  L  E  N  A  T  V  A  F  E  V  S  V  S  H         p.2820

          .         .         .         .         .         .       g.65622
 GACACTGTTCCAGTAAAATGGTTCCATAAGAGTGTGGAAATTAAGCCAAGTGACAAACAC       c.8520
 D  T  V  P  V  K  W  F  H  K  S  V  E  I  K  P  S  D  K  H         p.2840

          .         .         .         .         .         .       g.65682
 AGACTGGTCTCAGAAAGGAAAGTCCACAAGCTGATGCTGCAGAACATCTCCCCCTCAGAT       c.8580
 R  L  V  S  E  R  K  V  H  K  L  M  L  Q  N  I  S  P  S  D         p.2860

          .         .         .         .         .         .       g.65742
 GCTGGGGAATACACAGCTGTGGTCGGGCAATTGGAATGCAAAGCAAAACTGTTTGTGGAG       c.8640
 A  G  E  Y  T  A  V  V  G  Q  L  E  C  K  A  K  L  F  V  E         p.2880

   | 37      .         .         .         .         .         .    g.65922
 A | CATTACATATTACAAAAACCATGAAAAATATCGAGGTGCCTGAGACCAAAACTGCCTCT    c.8700
 T |   L  H  I  T  K  T  M  K  N  I  E  V  P  E  T  K  T  A  S      p.2900

          .         .         .         .         .         .       g.65982
 TTTGAGTGTGAGGTGTCCCACTTCAATGTCCCTTCCATGTGGCTGAAGAATGGTGTGGAA       c.8760
 F  E  C  E  V  S  H  F  N  V  P  S  M  W  L  K  N  G  V  E         p.2920

          .         .         .         .         .         .       g.66042
 ATTGAGATGAGTGAAAAGTTCAAGATAGTTGTGCAGGGAAAACTCCATCAGCTGATCATC       c.8820
 I  E  M  S  E  K  F  K  I  V  V  Q  G  K  L  H  Q  L  I  I         p.2940

          .         .         .         .         .         .       g.66102
 ATGAACACCAGCACAGAGGACTCGGCAGAATACACATTTGTCTGTGGCAATGACCAAGTC       c.8880
 M  N  T  S  T  E  D  S  A  E  Y  T  F  V  C  G  N  D  Q  V         p.2960

          .         .   | 38     .         .         .         .    g.66907
 AGTGCCACCCTGACAGTCACCC | CAATCATGATTACTTCCATGCTGAAAGACATCAACGCT    c.8940
 S  A  T  L  T  V  T  P |   I  M  I  T  S  M  L  K  D  I  N  A      p.2980

          .         .         .         .         .         .       g.66967
 GAAGAAAAAGACACTATTACTTTTGAGGTGACAGTGAACTATGAAGGCATCTCTTACAAA       c.9000
 E  E  K  D  T  I  T  F  E  V  T  V  N  Y  E  G  I  S  Y  K         p.3000

          .         .         .         .         .         .       g.67027
 TGGTTAAAGAATGGTGTGGAAATCAAATCAACTGACAAGTGCCAGATGAGAACCAAAAAG       c.9060
 W  L  K  N  G  V  E  I  K  S  T  D  K  C  Q  M  R  T  K  K         p.3020

          .         .         .         .         .         .       g.67087
 CTCACACACTCACTGAACATCAGGAATGTTCACTTTGGGGATGCTGCTGACTACACCTTT       c.9120
 L  T  H  S  L  N  I  R  N  V  H  F  G  D  A  A  D  Y  T  F         p.3040

          .         .         .         .    | 39    .         .    g.67664
 GTGGCTGGAAAAGCAACATCAACAGCCACACTTTATGTGGAAG | CTCGTCATATAGAATTT    c.9180
 V  A  G  K  A  T  S  T  A  T  L  Y  V  E  A |   R  H  I  E  F      p.3060

          .         .         .         .         .         .       g.67724
 AGGAAACACATTAAGGACATTAAGGTACTGGAGAAGAAGCGAGCCATGTTTGAATGTGAA       c.9240
 R  K  H  I  K  D  I  K  V  L  E  K  K  R  A  M  F  E  C  E         p.3080

          .         .         .         .         .         .       g.67784
 GTTTCTGAACCTGACATCACTGTACAGTGGATGAAAGATGACCAGGAACTGCAGATCACA       c.9300
 V  S  E  P  D  I  T  V  Q  W  M  K  D  D  Q  E  L  Q  I  T         p.3100

       | 40  .         .         .         .         .         .    g.67933
 GACAG | AATAAAGATTCAGAAGGAGAAATATGTCCACCGCCTTCTGATCCCATCCACCCGG    c.9360
 D  R  |  I  K  I  Q  K  E  K  Y  V  H  R  L  L  I  P  S  T  R      p.3120

          .         .         .         .         .         .       g.67993
 ATGTCTGATGCTGGGAAGTACACAGTGGTGGCAGGAGGCAACGTGTCAACTGCAAAACTC       c.9420
 M  S  D  A  G  K  Y  T  V  V  A  G  G  N  V  S  T  A  K  L         p.3140

          .         .         .         .         .  | 41      .    g.69199
 TTTGTAGAAGGCAGAGATGTTCGCATCCGAAGTATTAAAAAGGAGGTTCAG | GTCATTGAG    c.9480
 F  V  E  G  R  D  V  R  I  R  S  I  K  K  E  V  Q   | V  I  E      p.3160

          .         .         .         .         .         .       g.69259
 AAACAGCGTGCTGTTGTTGAATTTGAGGTCAATGAAGACGATGTTGATGCCCACTGGTAT       c.9540
 K  Q  R  A  V  V  E  F  E  V  N  E  D  D  V  D  A  H  W  Y         p.3180

          .         .         .         .         .         .       g.69319
 AAAGATGGCATTGAAATCAATTTCCAAGTTCAAGAACGACACAAATATGTAGTGGAAAGA       c.9600
 K  D  G  I  E  I  N  F  Q  V  Q  E  R  H  K  Y  V  V  E  R         p.3200

          .         .         .         .         .         .       g.69379
 AGAATCCACCGAATGTTTATCTCTGAGACCAGACAGAGCGATGCAGGAGAATACACCTTT       c.9660
 R  I  H  R  M  F  I  S  E  T  R  Q  S  D  A  G  E  Y  T  F         p.3220

          .         .         .         .    | 42    .         .    g.71008
 GTGGCAGGAAGGAACAGGAGTTCTGTCACTCTCTATGTCAATG | CTCCTGAACCGCCCCAA    c.9720
 V  A  G  R  N  R  S  S  V  T  L  Y  V  N  A |   P  E  P  P  Q      p.3240

          .         .         .         .         .         .       g.71068
 GTTCTGCAGGAGCTCCAGCCTGTCACTGTGCAGTCTGGCAAGCCTGCCCGCTTCTGTGCC       c.9780
 V  L  Q  E  L  Q  P  V  T  V  Q  S  G  K  P  A  R  F  C  A         p.3260

          .         .         .         .         .         .       g.71128
 GTGATATCCGGAAGACCACAGCCCAAAATTTCCTGGTACAAGGAAGAGCAGCTGCTTTCC       c.9840
 V  I  S  G  R  P  Q  P  K  I  S  W  Y  K  E  E  Q  L  L  S         p.3280

          .         .         .         .         .         .       g.71188
 ACTGGCTTCAAGTGCAAATTTCTTCATGATGGGCAAGAATACACGCTTTTGCTAATTGAA       c.9900
 T  G  F  K  C  K  F  L  H  D  G  Q  E  Y  T  L  L  L  I  E         p.3300

          .         .         .         .         .         .       g.71248
 GCCTTCCCAGAGGATGCGGCAGTCTATACCTGTGAAGCCAAGAATGACTATGGTGTTGCC       c.9960
 A  F  P  E  D  A  A  V  Y  T  C  E  A  K  N  D  Y  G  V  A         p.3320

          .         .         | 43         .         .         .    g.71532
 ACAACATCAGCTTCACTCTCAGTGGAAG | TTCCAGAAGTTGTGTCTCCTGATCAGGAAATG    c.10020
 T  T  S  A  S  L  S  V  E  V |   P  E  V  V  S  P  D  Q  E  M      p.3340

          .         .         .         .         .         .       g.71592
 CCTGTTTATCCACCTGCCATCATCACCCCGCTTCAGGACACTGTCACTTCTGAAGGGCAG       c.10080
 P  V  Y  P  P  A  I  I  T  P  L  Q  D  T  V  T  S  E  G  Q         p.3360

          .         .         .     | 44   .         .         .    g.76656
 CCAGCCCGTTTTCAATGCCGGGTTTCTGGAACAG | ATCTAAAAGTGTCGTGGTACAGCAAA    c.10140
 P  A  R  F  Q  C  R  V  S  G  T  D |   L  K  V  S  W  Y  S  K      p.3380

          .         .         .         .         .         .       g.76716
 GACAAGAAAATCAAGCCATCTCGGTTCTTTAGAATGACTCAATTTGAAGACACTTATCAA       c.10200
 D  K  K  I  K  P  S  R  F  F  R  M  T  Q  F  E  D  T  Y  Q         p.3400

          .         .         .         .         .         .       g.76776
 CTGGAAATTGCCGAAGCTTATCCAGAAGATGAAGGAACTTACACGTTTGTTGCTAGTAAT       c.10260
 L  E  I  A  E  A  Y  P  E  D  E  G  T  Y  T  F  V  A  S  N         p.3420

          .         .         .         .    | 45    .         .    g.77903
 GCTGTAGGCCAAGTATCAAGCACAGCCAACCTGAGTCTGGAAG | GATTTAGCAAATTTGAA    c.10320
 A  V  G  Q  V  S  S  T  A  N  L  S  L  E  G |   F  S  K  F  E      p.3440

          .         .         .         .         .         .       g.77963
 GAAAATACATCAAACTCCCAATGGCATGTCTCTTTATCAGTTTCATTTAAGAAGGAGCCC       c.10380
 E  N  T  S  N  S  Q  W  H  V  S  L  S  V  S  F  K  K  E  P         p.3460

          .         .         .         .         .         .       g.78023
 CTTGGCCAAAAGCCCAGCTTCATCCAGCCTCTGTCAAGCCTCAGGGTGCACAACGGGGAG       c.10440
 L  G  Q  K  P  S  F  I  Q  P  L  S  S  L  R  V  H  N  G  E         p.3480

          .         .         .         .         .         .       g.78083
 ACAGTCAGATTTCATGCGAGGGTTTCTGGCATTCCCAAGCCAGAAATCCAATGGTTTCAT       c.10500
 T  V  R  F  H  A  R  V  S  G  I  P  K  P  E  I  Q  W  F  H         p.3500

          .         .         .         .         .         .       g.78143
 AACCAGCAGCTAATTCTACCAACAAAAGATGTAGTTTTCCATTTTGAGGAGTCCACAGGC       c.10560
 N  Q  Q  L  I  L  P  T  K  D  V  V  F  H  F  E  E  S  T  G         p.3520

          .         .         .         .         .         .       g.78203
 ATGGCTTTAATGCTTATAGTTGATGCTTACTCAGAGCATGCTGGGCAGTACTCTTGCAAA       c.10620
 M  A  L  M  L  I  V  D  A  Y  S  E  H  A  G  Q  Y  S  C  K         p.3540

          .         .         .         .         .         | 46    g.79007
 GCAGCCAATAGTGCTGGGGAAGCCACTTGTGCAGCTACACTCACAGTGACTCCAAAAG | TG    c.10680
 A  A  N  S  A  G  E  A  T  C  A  A  T  L  T  V  T  P  K  V |       p.3560

          .         .         .         .         .         .       g.79067
 CAAGCCCTAGATAGGCAAAGTTCTGGGAAAGATGTAAGAGAGTCCGCCAAGTCCCAGGCA       c.10740
 Q  A  L  D  R  Q  S  S  G  K  D  V  R  E  S  A  K  S  Q  A         p.3580

          .         .         .         .         .         .       g.79127
 GTGGCAGATTCCTCTTTCACAAAGGAGGAGAGCAAAATATCTCAAAAGGAAATTAAGTCA       c.10800
 V  A  D  S  S  F  T  K  E  E  S  K  I  S  Q  K  E  I  K  S         p.3600

          .         .         .         .         .         .       g.79187
 TTTCAAGGATCATCATATGAATATGAAGTGCAGGTTTTTGAAAGTGTATCTCAAAGTTCC       c.10860
 F  Q  G  S  S  Y  E  Y  E  V  Q  V  F  E  S  V  S  Q  S  S         p.3620

          .         .         .         .         .         .       g.79247
 ATCCACACAGCTGCATCTGTTCAAGATACACAGTTGTGCCATACTGCATCCCTTTCACAA       c.10920
 I  H  T  A  A  S  V  Q  D  T  Q  L  C  H  T  A  S  L  S  Q         p.3640

          .         .         .         .         .         .       g.79307
 ATTGCAGAAAGCACTGAGCTATCTAAGGAATGTGCTAAAGAGTCCACGGGTGAGGCGCCC       c.10980
 I  A  E  S  T  E  L  S  K  E  C  A  K  E  S  T  G  E  A  P         p.3660

          .         .         .         .         .         .       g.79367
 AAGATTTTCCTGCATCTTCAGGACGTCACTGTAAAGTGCGGTGACACGGCTCAATTCCTC       c.11040
 K  I  F  L  H  L  Q  D  V  T  V  K  C  G  D  T  A  Q  F  L         p.3680

          .         .         .         .         .         .       g.79427
 TGTGTTTTAAAAGATGATTCTTTCATTGATGTAACCTGGACTCACGAAGGTGCAAAGATA       c.11100
 C  V  L  K  D  D  S  F  I  D  V  T  W  T  H  E  G  A  K  I         p.3700

          .         .         .         .         .         .       g.79487
 GAGGAATCCGAGAGACTGAAACAATCACAAAATGGAAATATTCAGTTTCTTACCATATGT       c.11160
 E  E  S  E  R  L  K  Q  S  Q  N  G  N  I  Q  F  L  T  I  C         p.3720

          .         .         .         .         .         .       g.79547
 AATGTTCAGCTGGTAGACCAAGGACTATACAGCTGCATTGTACACAATGACTGTGGAGAG       c.11220
 N  V  Q  L  V  D  Q  G  L  Y  S  C  I  V  H  N  D  C  G  E         p.3740

          .         .         .     | 47   .         .         .    g.82648
 AGGACAACGTCAGCAGTACTAAGTGTAGAAGGTG | CTCCTGAATCAATTTTGCATGAGAGG    c.11280
 R  T  T  S  A  V  L  S  V  E  G  A |   P  E  S  I  L  H  E  R      p.3760

          .         .         .  | 49      .         .         .    g.93910
 ATTGAACAAGAGATTGAGATGGAAATGAAAG | AGTTTTCTAGTTCTTTTCTGTCTGCCGAG    c.11340
 I  E  Q  E  I  E  M  E  M  K  E |   F  S  S  S  F  L  S  A  E      p.3780
                                 ^  contains exon 48, an alternatively spliced
                                    3' terminal exon (see intron 47)

          .         .         .         .         .         .       g.93970
 GAAGAAGGACTTCATAGCGCCGAACTTCAATTATCTAAAATAAATGAAACACTTGAACTT       c.11400
 E  E  G  L  H  S  A  E  L  Q  L  S  K  I  N  E  T  L  E  L         p.3800

          .         .         .         .         .         .       g.94030
 TTGTCTGAATCTCCAGTTTACCCAACTAAATTTGATTCCGAAAAGGAAGGCACTGGCCCA       c.11460
 L  S  E  S  P  V  Y  P  T  K  F  D  S  E  K  E  G  T  G  P         p.3820

          .         .         .         .         .         .       g.94090
 ATTTTCATCAAAGAAGTGTCAAATGCTGATATAAGCATGGGGGATGTGGCTACACTGTCT       c.11520
 I  F  I  K  E  V  S  N  A  D  I  S  M  G  D  V  A  T  L  S         p.3840

          .         .         .         .         .         .       g.94150
 GTAACTGTCATTGGCATCCCCAAACCTAAAATTCAGTGGTTCTTTAATGGAGTGCTATTA       c.11580
 V  T  V  I  G  I  P  K  P  K  I  Q  W  F  F  N  G  V  L  L         p.3860

          .         .         .         .         .         .       g.94210
 ACCCCTTCTGCTGACTACAAATTTGTTTTTGACGGTGATGATCATAGCCTGATCATTCTG       c.11640
 T  P  S  A  D  Y  K  F  V  F  D  G  D  D  H  S  L  I  I  L         p.3880

          .         .         .         .         .         .       g.94270
 TTCACCAAATTGGAGGATGAGGGAGAGTATACATGTATGGCCAGTAATGACTATGGAAAG       c.11700
 F  T  K  L  E  D  E  G  E  Y  T  C  M  A  S  N  D  Y  G  K         p.3900

          .         .         .         .         .         .       g.94330
 ACAATATGTAGTGCCTATCTAAAAATTAATTCCAAAGGAGAGGGTCACAAAGACACTGAA       c.11760
 T  I  C  S  A  Y  L  K  I  N  S  K  G  E  G  H  K  D  T  E         p.3920

          .         .         .         .         .         .       g.94390
 ACAGAATCAGCAGTGGCAAAATCTCTGGAAAAGCTGGGAGGTCCTTGTCCTCCTCACTTC       c.11820
 T  E  S  A  V  A  K  S  L  E  K  L  G  G  P  C  P  P  H  F         p.3940

          .         .         .         .         .         .       g.94450
 CTTAAGGAGTTAAAACCAATTCGCTGTGCTCAAGGGCTTCCTGCCATCTTTGAGTACACA       c.11880
 L  K  E  L  K  P  I  R  C  A  Q  G  L  P  A  I  F  E  Y  T         p.3960

          .         .         .         .         .         .       g.94510
 GTGGTTGGAGAGCCTGCCCCTACTGTTACATGGTTCAAAGAAAACAAGCAGCTTTGCACC       c.11940
 V  V  G  E  P  A  P  T  V  T  W  F  K  E  N  K  Q  L  C  T         p.3980

          .         .         .         .         .         .       g.94570
 AGTGTTTATTACACTATCATTCATAACCCTAATGGCTCTGGAACTTTCATTGTCAATGAC       c.12000
 S  V  Y  Y  T  I  I  H  N  P  N  G  S  G  T  F  I  V  N  D         p.4000

          .         .         .         .         .         .       g.94630
 CCTCAGAGGGAAGACAGTGGCCTCTATATCTGTAAAGCAGAGAATATGTTGGGTGAGTCC       c.12060
 P  Q  R  E  D  S  G  L  Y  I  C  K  A  E  N  M  L  G  E  S         p.4020

          .         .         .         .         .         .       g.94690
 ACCTGTGCAGCAGAGCTGCTTGTGCTTCTGGAAGACACAGACATGACTGATACCCCCTGC       c.12120
 T  C  A  A  E  L  L  V  L  L  E  D  T  D  M  T  D  T  P  C         p.4040

          .         .         .         .         .         .       g.94750
 AAAGCAAAGTCCACACCAGAGGCTCCTGAGGATTTTCCACAGACACCCTTAAAGGGTCCC       c.12180
 K  A  K  S  T  P  E  A  P  E  D  F  P  Q  T  P  L  K  G  P         p.4060

          .         .         .         .         .         .       g.94810
 GCAGTTGAAGCACTTGACTCAGAGCAGGAAATTGCAACGTTTGTAAAAGACACCATTTTG       c.12240
 A  V  E  A  L  D  S  E  Q  E  I  A  T  F  V  K  D  T  I  L         p.4080

          .         .         .         .         .         .       g.94870
 AAAGCTGCTTTAATTACAGAAGAAAACCAGCAACTATCTTATGAGCATATTGCTAAAGCC       c.12300
 K  A  A  L  I  T  E  E  N  Q  Q  L  S  Y  E  H  I  A  K  A         p.4100

          .         .         .         .         .         .       g.94930
 AATGAATTGAGCAGTCAGCTTCCTTTGGGAGCTCAGGAATTGCAATCCATTTTGGAGCAA       c.12360
 N  E  L  S  S  Q  L  P  L  G  A  Q  E  L  Q  S  I  L  E  Q         p.4120

          .         .         .         .         .         .       g.94990
 GACAAGCTCACTCCTGAAAGCACCAGGGAATTTCTTTGCATCAATGGCAGTATTCACTTT       c.12420
 D  K  L  T  P  E  S  T  R  E  F  L  C  I  N  G  S  I  H  F         p.4140

          .         .         .         .         .         .       g.95050
 CAGCCTCTCAAGGAACCATCTCCCAACCTACAGCTGCAGATTGTACAGTCCCAGAAAACC       c.12480
 Q  P  L  K  E  P  S  P  N  L  Q  L  Q  I  V  Q  S  Q  K  T         p.4160

          .         .         .         .         .         .       g.95110
 TTCTCCAAAGAAGGTATTCTAATGCCTGAAGAGCCTGAGACACAGGCAGTTCTATCAGAT       c.12540
 F  S  K  E  G  I  L  M  P  E  E  P  E  T  Q  A  V  L  S  D         p.4180

          .         .         .         .         .         .       g.95170
 ACCGAGAAAATCTTCCCAAGTGCCATGTCCATAGAACAAATTAATTCATTAACAGTTGAG       c.12600
 T  E  K  I  F  P  S  A  M  S  I  E  Q  I  N  S  L  T  V  E         p.4200

          .         .         .         .         .         .       g.95230
 CCTCTGAAAACTTTATTAGCTGAACCTGAAGGGAATTATCCACAGTCTTCAATAGAACCT       c.12660
 P  L  K  T  L  L  A  E  P  E  G  N  Y  P  Q  S  S  I  E  P         p.4220

          .         .         .         .         .         .       g.95290
 CCAATGCATTCTTATCTAACCTCTGTGGCTGAGGAAGTACTTTCACCAAAAGAAAAGACA       c.12720
 P  M  H  S  Y  L  T  S  V  A  E  E  V  L  S  P  K  E  K  T         p.4240

          .         .         .         .         .         .       g.95350
 GTATCTGACACCAACAGAGAGCAAAGAGTGACTCTTCAAAAGCAAGAGGCACAAAGTGCG       c.12780
 V  S  D  T  N  R  E  Q  R  V  T  L  Q  K  Q  E  A  Q  S  A         p.4260

          .         .         .         .         .         .       g.95410
 CTCATCTTGAGTCAGAGCTTAGCTGAGGGACACGTGGAGAGTCTCCAGAGTCCTGATGTC       c.12840
 L  I  L  S  Q  S  L  A  E  G  H  V  E  S  L  Q  S  P  D  V         p.4280

          .         .         .         .         .         .       g.95470
 ATGATCTCTCAGGTAAACTATGAGCCCCTAGTCCCTTCAGAACACTCATGCACAGAAGGA       c.12900
 M  I  S  Q  V  N  Y  E  P  L  V  P  S  E  H  S  C  T  E  G         p.4300

          .         .         .         .         .         .       g.95530
 GGTAAAATTTTGATAGAAAGTGCAAATCCACTGGAAAATGCAGGGCAAGATTCTGCGGTC       c.12960
 G  K  I  L  I  E  S  A  N  P  L  E  N  A  G  Q  D  S  A  V         p.4320

          .         .         .         .         .         .       g.95590
 AGAATTGAGGAAGGCAAGTCCTTAAGATTTCCACTAGCACTTGAAGAAAAGCAGGTACTG       c.13020
 R  I  E  E  G  K  S  L  R  F  P  L  A  L  E  E  K  Q  V  L         p.4340

          .         .         .         .         .         .       g.95650
 CTCAAAGAAGAGCATTCTGACAACGTGGTGATGCCCCCAGACCAAATCATTGAGTCTAAA       c.13080
 L  K  E  E  H  S  D  N  V  V  M  P  P  D  Q  I  I  E  S  K         p.4360

          .         .         .         .         .         .       g.95710
 AGAGAGCCCGTGGCAATAAAGAAAGTGCAGGAGGTACAGGGAAGGGACCTTCTTTCTAAG       c.13140
 R  E  P  V  A  I  K  K  V  Q  E  V  Q  G  R  D  L  L  S  K         p.4380

          .         .         .         .         .         .       g.95770
 GAAAGCTTGCTTTCTGGTATTCCAGAAGAGCAGAGATTAAACCTGAAAATTCAAATCTGC       c.13200
 E  S  L  L  S  G  I  P  E  E  Q  R  L  N  L  K  I  Q  I  C         p.4400

          .         .         .         .         .         .       g.95830
 CGGGCTTTGCAAGCAGCCGTGGCCAGCGAGCAGCCAGGTCTTTTCTCTGAGTGGCTAAGA       c.13260
 R  A  L  Q  A  A  V  A  S  E  Q  P  G  L  F  S  E  W  L  R         p.4420

          .         .         .         .         .         .       g.95890
 AATATTGAAAAGGTGGAGGTCGAGGCTGTAAACATCACCCAAGAGCCCAGACACATCATG       c.13320
 N  I  E  K  V  E  V  E  A  V  N  I  T  Q  E  P  R  H  I  M         p.4440

          .         .         .         .         .         .       g.95950
 TGCATGTACCTTGTTACTTCGGCAAAGTCTGTAACAGAAGAAGTAACCATCATTATTGAA       c.13380
 C  M  Y  L  V  T  S  A  K  S  V  T  E  E  V  T  I  I  I  E         p.4460

          .         .         .         .         .         .       g.96010
 GATGTTGATCCTCAAATGGCTAACCTGAAAATGGAACTTAGGGATGCTTTGTGTGCTATT       c.13440
 D  V  D  P  Q  M  A  N  L  K  M  E  L  R  D  A  L  C  A  I         p.4480

          .         .         .         .         .         .       g.96070
 ATATATGAGGAAATAGACATCCTAACAGCTGAGGGTCCTAGAATTCAGCAAGGAGCCAAA       c.13500
 I  Y  E  E  I  D  I  L  T  A  E  G  P  R  I  Q  Q  G  A  K         p.4500

          .         .         .         .         .         .       g.96130
 ACAAGTTTGCAAGAAGAAATGGATTCTTTTTCAGGTTCACAGAAGGTTGAACCCATTACT       c.13560
 T  S  L  Q  E  E  M  D  S  F  S  G  S  Q  K  V  E  P  I  T         p.4520

          .         .         .         .         .         .       g.96190
 GAACCAGAAGTTGAATCTAAATATCTGATCTCAACTGAAGAGGTCAGTTATTTTAACGTG       c.13620
 E  P  E  V  E  S  K  Y  L  I  S  T  E  E  V  S  Y  F  N  V         p.4540

          .         .         .         .         .         .       g.96250
 CAAAGTAGGGTTAAATATTTGGATGCCACACCTGTCACTAAAGGGGTTGCTTCAGCTGTT       c.13680
 Q  S  R  V  K  Y  L  D  A  T  P  V  T  K  G  V  A  S  A  V         p.4560

          .         .         .         .         .         .       g.96310
 GTCTCTGACGAAAAACAAGATGAGAGTCTGAAACCATCAGAGGAAAAAGAGGAGTCTTCC       c.13740
 V  S  D  E  K  Q  D  E  S  L  K  P  S  E  E  K  E  E  S  S         p.4580

          .         .         .         .         .         .       g.96370
 TCTGAAAGTGGTACTGAGGAGGTTGCTACAGTAAAGATACAGGAAGCTGAGGGTGGCTTA       c.13800
 S  E  S  G  T  E  E  V  A  T  V  K  I  Q  E  A  E  G  G  L         p.4600

          .         .         .         .         .         .       g.96430
 ATCAAAGAGGATGGCCCCATGATACATACACCTTTAGTGGACACTGTTTCTGAGGAAGGT       c.13860
 I  K  E  D  G  P  M  I  H  T  P  L  V  D  T  V  S  E  E  G         p.4620

          .         .         .         .         .         .       g.96490
 GATATTGTACACCTCACAACATCCATAACAAATGCTAAAGAGGTGAATTGGTATTTTGAG       c.13920
 D  I  V  H  L  T  T  S  I  T  N  A  K  E  V  N  W  Y  F  E         p.4640

          .         .         .         .         .         .       g.96550
 AATAAACTGGTGCCTTCAGATGAAAAGTTCAAGTGTTTACAAGATCAAAATACATATACG       c.13980
 N  K  L  V  P  S  D  E  K  F  K  C  L  Q  D  Q  N  T  Y  T         p.4660

          .         .         .         .         .         .       g.96610
 CTAGTCATCGACAAAGTAAATACCGAAGACCATCAAGGAGAGTATGTCTGTGAGGCCTTG       c.14040
 L  V  I  D  K  V  N  T  E  D  H  Q  G  E  Y  V  C  E  A  L         p.4680

          .         .         .         .         .   | 50     .    g.97450
 AATGACAGCGGAAAAACAGCAACTTCAGCCAAACTCACTGTAGTAAAAAGAG | CTGCCCCA    c.14100
 N  D  S  G  K  T  A  T  S  A  K  L  T  V  V  K  R  A |   A  P      p.4700

          .         .         .         .         .         .       g.97510
 GTGATCAAGAGGAAAATCGAACCCCTGGAAGTAGCACTGGGCCACCTAGCCAAATTCACC       c.14160
 V  I  K  R  K  I  E  P  L  E  V  A  L  G  H  L  A  K  F  T         p.4720

          .         .         .         .         .         .       g.97570
 TGTGAGATCCAAAGTGCTCCCAATGTCCGGTTCCAGTGGTTTAAAGCTGGCCGAGAAATT       c.14220
 C  E  I  Q  S  A  P  N  V  R  F  Q  W  F  K  A  G  R  E  I         p.4740

          .         .         .         .         .         .       g.97630
 TATGAGAGTGACAAGTGTTCTATTCGATCTTCAAAGTATATCTCCAGCCTTGAAATCCTG       c.14280
 Y  E  S  D  K  C  S  I  R  S  S  K  Y  I  S  S  L  E  I  L         p.4760

          .         .         .         .         .         .       g.97690
 AGAACCCAGGTGGTTGACTGCGGCGAGTATACATGCAAAGCTTCCAATGAGTATGGCAGT       c.14340
 R  T  Q  V  V  D  C  G  E  Y  T  C  K  A  S  N  E  Y  G  S         p.4780

          .         .         .  | 51      .         .         .    g.99757
 GTCAGCTGTACAGCCACACTAACTGTGACAG | AGGCATATCCACCAACCTTTCTCTCCAGA    c.14400
 V  S  C  T  A  T  L  T  V  T  E |   A  Y  P  P  T  F  L  S  R      p.4800

          .         .         .         .         .         .       g.99817
 CCTAAGTCCCTTACAACTTTTGTGGGTAAGGCAGCCAAGTTCATCTGCACAGTGACAGGG       c.14460
 P  K  S  L  T  T  F  V  G  K  A  A  K  F  I  C  T  V  T  G         p.4820

          .         .         .         .         .         .       g.99877
 ACTCCTGTGATAGAAACCATTTGGCAGAAAGATGGTGCTGCACTCTCACCTTCACCTAAC       c.14520
 T  P  V  I  E  T  I  W  Q  K  D  G  A  A  L  S  P  S  P  N         p.4840

          .         .         .         .         .         .       g.99937
 TGGAGGATTTCCGACGCAGAAAACAAACACATTTTAGAACTCTCAAACCTTACCATTCAA       c.14580
 W  R  I  S  D  A  E  N  K  H  I  L  E  L  S  N  L  T  I  Q         p.4860

          .         .         .         .         .         .       g.99997
 GATAGAGGAGTTTATTCTTGTAAGGCTTCCAACAAGTTTGGAGCAGACATCTGCCAAGCA       c.14640
 D  R  G  V  Y  S  C  K  A  S  N  K  F  G  A  D  I  C  Q  A         p.4880

          .         .         .         .         .         .       g.100057
 GAGTTGATCATCATTGATAAGCCACATTTCATTAAAGAATTAGAGCCTGTGCAGTCCGCT       c.14700
 E  L  I  I  I  D  K  P  H  F  I  K  E  L  E  P  V  Q  S  A         p.4900

          .         .         .         .         .         .       g.100117
 ATCAATAAGAAGGTCCACCTTGAGTGCCAAGTAGATGAAGACAGAAAAGTCACAGTTACG       c.14760
 I  N  K  K  V  H  L  E  C  Q  V  D  E  D  R  K  V  T  V  T         p.4920

          .         .         .         .         .         .       g.100177
 TGGAGCAAAGATGGGCAAAAACTCCCCCCAGGGAAAGATTATAAGATCTGTTTTGAAGAT       c.14820
 W  S  K  D  G  Q  K  L  P  P  G  K  D  Y  K  I  C  F  E  D         p.4940

          .         .         .         .         .         .       g.100237
 AAAATAGCAACACTTGAGATTCCTTTGGCCAAACTGAAAGATTCAGGAACCTATGTCTGT       c.14880
 K  I  A  T  L  E  I  P  L  A  K  L  K  D  S  G  T  Y  V  C         p.4960

          .         .         .         .         .      | 52  .    g.100819
 ACAGCTTCAAATGAGGCTGGAAGCAGCTCCTGCTCAGCCACAGTCACTGTCAGAG | AGCCA    c.14940
 T  A  S  N  E  A  G  S  S  S  C  S  A  T  V  T  V  R  E |   P      p.4980

          .         .         .         .         .         .       g.100879
 CCATCCTTCGTGAAGAAGGTGGATCCCTCTTATTTAATGCTCCCAGGTGAATCAGCACGC       c.15000
 P  S  F  V  K  K  V  D  P  S  Y  L  M  L  P  G  E  S  A  R         p.5000

          .         .         .         .         .         .       g.100939
 CTCCATTGCAAGCTGAAAGGCTCACCTGTGATCCAGGTTACTTGGTTTAAAAATAACAAA       c.15060
 L  H  C  K  L  K  G  S  P  V  I  Q  V  T  W  F  K  N  N  K         p.5020

          .         .         .         .         .         .       g.100999
 GAACTCAGTGAAAGTAACACAGTCCGAATGTATTTTGTCAATTCTGAGGCTATACTTGAT       c.15120
 E  L  S  E  S  N  T  V  R  M  Y  F  V  N  S  E  A  I  L  D         p.5040

          .         .         .         .         .         .       g.101059
 ATTACGGATGTAAAAGTTGAAGACAGTGGGAGTTACTCATGTGAAGCAGTGAATGACGTC       c.15180
 I  T  D  V  K  V  E  D  S  G  S  Y  S  C  E  A  V  N  D  V         p.5060

          .         .         .        | 53.         .         .    g.101219
 GGCAGTGATAGCTGCAGTACTGAAATAGTTATCAAAG | AACCTCCTTCTTTCATCAAAACT    c.15240
 G  S  D  S  C  S  T  E  I  V  I  K  E |   P  P  S  F  I  K  T      p.5080

          .         .         .         .         .         .       g.101279
 CTTGAGCCTGCAGACATAGTGAGAGGAACAAATGCTCTACTTCAGTGTGAAGTCTCAGGC       c.15300
 L  E  P  A  D  I  V  R  G  T  N  A  L  L  Q  C  E  V  S  G         p.5100

          .         .         .         .         .         .       g.101339
 ACTGGACCATTTGAAATTAGCTGGTTCAAAGACAAGAAACAAATTCGAAGTAGTAAAAAA       c.15360
 T  G  P  F  E  I  S  W  F  K  D  K  K  Q  I  R  S  S  K  K         p.5120

          .         .         .         .         .         .       g.101399
 TACAGATTGTTTTCTCAGAAGTCTCTTGTGTGTCTGGAGATCTTTTCGTTTAATAGTGCA       c.15420
 Y  R  L  F  S  Q  K  S  L  V  C  L  E  I  F  S  F  N  S  A         p.5140

          .         .         .         .         .         .       g.101459
 GATGTTGGTGAATATGAATGTGTTGTTGCTAATGAAGTCGGCAAGTGTGGCTGCATGGCA       c.15480
 D  V  G  E  Y  E  C  V  V  A  N  E  V  G  K  C  G  C  M  A         p.5160

          .       | 54 .         .         .         .         .    g.101954
 ACCCACTTACTCAAAG | AACCTCCAACCTTTGTAAAGAAAGTAGATGATTTGATTGCACTA    c.15540
 T  H  L  L  K  E |   P  P  T  F  V  K  K  V  D  D  L  I  A  L      p.5180

          .         .         .         .         .         .       g.102014
 GGAGGACAAACCGTTACCCTGCAAGCTGCTGTGAGAGGGTCAGAGCCCATTTCTGTCACA       c.15600
 G  G  Q  T  V  T  L  Q  A  A  V  R  G  S  E  P  I  S  V  T         p.5200

          .         .         .         .         .         .       g.102074
 TGGATGAAAGGTCAAGAGGTCATCAGAGAAGACGGAAAAATCAAAATGAGCTTTTCCAAT       c.15660
 W  M  K  G  Q  E  V  I  R  E  D  G  K  I  K  M  S  F  S  N         p.5220

          .         .         .         .         .         .       g.102134
 GGTGTTGCAGTCTTGATAATCCCTGATGTTCAGATTAGTTTTGGAGGCAAATACACGTGC       c.15720
 G  V  A  V  L  I  I  P  D  V  Q  I  S  F  G  G  K  Y  T  C         p.5240

          .         .         .         .         .      | 55  .    g.102290
 CTGGCTGAAAATGAAGCTGGAAGCCAAACATCTGTTGGGGAATTAATAGTTAAAG | AACCT    c.15780
 L  A  E  N  E  A  G  S  Q  T  S  V  G  E  L  I  V  K  E |   P      p.5260

          .         .         .         .         .         .       g.102350
 GCCAAAATCATTGAGCGAGCAGAACTGATCCAGGTGACAGCAGGAGATCCCGCCACACTG       c.15840
 A  K  I  I  E  R  A  E  L  I  Q  V  T  A  G  D  P  A  T  L         p.5280

          .         .         .         .         .         .       g.102410
 GAGTACACAGTGGCAGGCACGCCAGAACTGAAGCCCAAATGGTACAAAGATGGGAGACCC       c.15900
 E  Y  T  V  A  G  T  P  E  L  K  P  K  W  Y  K  D  G  R  P         p.5300

          .         .         .         .         .         .       g.102470
 TTGGTCGCCAGTAAAAAATACCGAATAAGTTTTAAAAACAATGTTGCCCAGCTCAAATTT       c.15960
 L  V  A  S  K  K  Y  R  I  S  F  K  N  N  V  A  Q  L  K  F         p.5320

          .         .         .         .         .         .       g.102530
 TATTCAGCTGAGCTGCACGACAGTGGCCAATACACATTTGAGATTTCCAATGAAGTGGGC       c.16020
 Y  S  A  E  L  H  D  S  G  Q  Y  T  F  E  I  S  N  E  V  G         p.5340

          .         .         .     | 56   .         .         .    g.102707
 AGCAGCTCCTGTGAGACTACATTCACTGTATTAG | ATCGAGACATTGCTCCATTTTTTACC    c.16080
 S  S  S  C  E  T  T  F  T  V  L  D |   R  D  I  A  P  F  F  T      p.5360

          .         .         .         .         .         .       g.102767
 AAACCCTTGCGCAACGTGGATAGTGTTGTTAATGGTACCTGCAGACTGGACTGCAAAATT       c.16140
 K  P  L  R  N  V  D  S  V  V  N  G  T  C  R  L  D  C  K  I         p.5380

          .         .         .         .         .         .       g.102827
 GCAGGCTCCCTCCCCATGAGGGTGTCCTGGTTTAAGGATGGCAAAGAAATAGCTGCTTCT       c.16200
 A  G  S  L  P  M  R  V  S  W  F  K  D  G  K  E  I  A  A  S         p.5400

          .         .         .         .         .         .       g.102887
 GACAGATACAGGATAGCATTTGTGGAAGGCACAGCCTCTTTGGAGATCATCAGAGTAGAC       c.16260
 D  R  Y  R  I  A  F  V  E  G  T  A  S  L  E  I  I  R  V  D         p.5420

          .         .         .         .         .         .       g.102947
 ATGAATGATGCAGGGAATTTCACTTGTCGAGCCACAAATTCCGTGGGAAGCAAAGACAGC       c.16320
 M  N  D  A  G  N  F  T  C  R  A  T  N  S  V  G  S  K  D  S         p.5440

          .         .   | 57     .         .         .         .    g.103122
 AGTGGAGCCCTGATTGTGCAAG | AACCACCCAGTTTTGTAACTAAACCCGGCTCAAAGGAT    c.16380
 S  G  A  L  I  V  Q  E |   P  P  S  F  V  T  K  P  G  S  K  D      p.5460

          .         .         .         .         .         .       g.103182
 GTTCTGCCTGGCTCAGCAGTCTGCCTGAAGAGCACTTTCCAAGGATCTACTCCTCTCACA       c.16440
 V  L  P  G  S  A  V  C  L  K  S  T  F  Q  G  S  T  P  L  T         p.5480

          .         .         .         .         .         .       g.103242
 ATCAGATGGTTTAAGGGCAACAAAGAGCTGGTTTCTGGTGGAAGCTGCTATATTACCAAA       c.16500
 I  R  W  F  K  G  N  K  E  L  V  S  G  G  S  C  Y  I  T  K         p.5500

          .         .         .         .         .         .       g.103302
 GAAGCTTTAGAGAGTTCCCTGGAACTCTATTTAGTAAAAACCTCTGATTCGGGCACGTAC       c.16560
 E  A  L  E  S  S  L  E  L  Y  L  V  K  T  S  D  S  G  T  Y         p.5520

          .         .         .         .         .         .       g.103362
 ACATGTAAAGTCAGCAATGTCGCTGGAGGGGTGGAATGCAGTGCAAACTTGTTTGTAAAA       c.16620
 T  C  K  V  S  N  V  A  G  G  V  E  C  S  A  N  L  F  V  K         p.5540

   | 58      .         .         .         .         .         .    g.103514
 G | AACCTGCCACATTTGTTGAAAAGTTAGAGCCATCACAGCTGTTAAAGAAGGGAGATGCC    c.16680
 E |   P  A  T  F  V  E  K  L  E  P  S  Q  L  L  K  K  G  D  A      p.5560

          .         .         .         .         .         .       g.103574
 ACCCAGCTAGCCTGCAAAGTAACTGGTACCCCTCCAATTAAAATAACATGGTTTGCAAAT       c.16740
 T  Q  L  A  C  K  V  T  G  T  P  P  I  K  I  T  W  F  A  N         p.5580

          .         .         .         .         .         .       g.103634
 GATAGAGAAATTAAGGAGAGCAGCAAACACAGAATGTCTTTTGTGGAGTCTACTGCAGTT       c.16800
 D  R  E  I  K  E  S  S  K  H  R  M  S  F  V  E  S  T  A  V         p.5600

          .         .         .         .         .         .       g.103694
 CTAAGACTGACAGATGTTGGCATCGAAGACAGTGGTGAATATATGTGTGAGGCCCAAAAT       c.16860
 L  R  L  T  D  V  G  I  E  D  S  G  E  Y  M  C  E  A  Q  N         p.5620

          .         .         .         .    | 59    .         .    g.103848
 GAGGCTGGCAGTGACCACTGCAGTAGCATTGTAATAGTCAAAG | AGTCACCTTATTTTACC    c.16920
 E  A  G  S  D  H  C  S  S  I  V  I  V  K  E |   S  P  Y  F  T      p.5640

          .         .         .         .         .         .       g.103908
 AAGGAATTTAAGCCAATTGAAGTCTTAAAGGAGTACGATGTCATGTTGCTGGCTGAGGTG       c.16980
 K  E  F  K  P  I  E  V  L  K  E  Y  D  V  M  L  L  A  E  V         p.5660

          .         .         .         .         .         .       g.103968
 GCAGGCACTCCTCCCTTTGAGATCACTTGGTTCAAAGATAACACAATCCTGCGAAGTGGT       c.17040
 A  G  T  P  P  F  E  I  T  W  F  K  D  N  T  I  L  R  S  G         p.5680

          .         .         .         .         .         .       g.104028
 AGAAAGTATAAGACTTTCATTCAGGATCATCTGGTTAGCCTGCAGATCCTCAAGTTTGTA       c.17100
 R  K  Y  K  T  F  I  Q  D  H  L  V  S  L  Q  I  L  K  F  V         p.5700

          .         .         .         .         .         .       g.104088
 GCTGCAGATGCTGGCGAATACCAGTGTCGGGTGACCAATGAGGTGGGCAGCAGCATCTGC       c.17160
 A  A  D  A  G  E  Y  Q  C  R  V  T  N  E  V  G  S  S  I  C         p.5720

          .         .   | 60     .         .         .         .    g.104257
 AGTGCCAGGGTGACTTTAAGAG | AACCCCCATCCTTCATAAAGAAGATCGAGAGTACCAGC    c.17220
 S  A  R  V  T  L  R  E |   P  P  S  F  I  K  K  I  E  S  T  S      p.5740

          .         .         .         .         .         .       g.104317
 TCCCTCCGGGGAGGCACAGCTGCCTTCCAGGCCACTCTGAAGGGCTCCTTGCCAATTACG       c.17280
 S  L  R  G  G  T  A  A  F  Q  A  T  L  K  G  S  L  P  I  T         p.5760

          .         .         .         .         .         .       g.104377
 GTGACTTGGCTAAAAGACAGCGATGAAATCACTGAAGACGATAATATAAGAATGACCTTT       c.17340
 V  T  W  L  K  D  S  D  E  I  T  E  D  D  N  I  R  M  T  F         p.5780

          .         .         .         .         .         .       g.104437
 GAGAACAATGTGGCCAGTTTGTACCTCAGTGGCATTGAAGTCAAGCATGATGGGAAATAT       c.17400
 E  N  N  V  A  S  L  Y  L  S  G  I  E  V  K  H  D  G  K  Y         p.5800

          .         .         .         .         .         .       g.104497
 GTCTGTCAGGCCAAAAATGATGCAGGAATACAAAGATGTTCTGCATTACTCTCAGTAAAA       c.17460
 V  C  Q  A  K  N  D  A  G  I  Q  R  C  S  A  L  L  S  V  K         p.5820

   | 61      .         .         .         .         .         .    g.104658
 G | AACCTGCAACAATCACCGAGGAAGCTGTGTCTATAGATGTCACCCAAGGAGACCCAGCC    c.17520
 E |   P  A  T  I  T  E  E  A  V  S  I  D  V  T  Q  G  D  P  A      p.5840

          .         .         .         .         .         .       g.104718
 ACTTTGCAGGTTAAATTTTCAGGGACTAAGGAGATTACAGCCAAATGGTTTAAAGATGGC       c.17580
 T  L  Q  V  K  F  S  G  T  K  E  I  T  A  K  W  F  K  D  G         p.5860

          .         .         .         .         .         .       g.104778
 CAAGAACTGACCCTGGGCTCAAAATATAAAATCAGTGTCACTGATACAGTCTCAATACTG       c.17640
 Q  E  L  T  L  G  S  K  Y  K  I  S  V  T  D  T  V  S  I  L         p.5880

          .         .         .         .         .         .       g.104838
 AAGATTATTTCTACAGAAAAGAAAGATAGTGGAGAATATACTTTCGAGGTCCAAAATGAT       c.17700
 K  I  I  S  T  E  K  K  D  S  G  E  Y  T  F  E  V  Q  N  D         p.5900

          .         .         .         . | 62       .         .    g.105030
 GTTGGGAGGAGCAGCTGCAAGGCTAGAATTAATGTATTAG | ATCTTATCATACCTCCTTCA    c.17760
 V  G  R  S  S  C  K  A  R  I  N  V  L  D |   L  I  I  P  P  S      p.5920

          .         .         .         .         .         .       g.105090
 TTCACCAAAAAGCTGAAGAAAATGGACAGCATTAAAGGTTCTTTCATTGATTTAGAATGT       c.17820
 F  T  K  K  L  K  K  M  D  S  I  K  G  S  F  I  D  L  E  C         p.5940

          .         .         .         .         .         .       g.105150
 ATAGTGGCTGGGTCACATCCCATAAGCATCCAGTGGTTCAAAGATGACCAAGAAATATCA       c.17880
 I  V  A  G  S  H  P  I  S  I  Q  W  F  K  D  D  Q  E  I  S         p.5960

          .         .         .         .         .         .       g.105210
 GCTAGTGAAAAGTACAAATTCTCTTTTCATGACAATACTGCCTTCTTGGAAATCAGCCAG       c.17940
 A  S  E  K  Y  K  F  S  F  H  D  N  T  A  F  L  E  I  S  Q         p.5980

          .         .         .         .         .         .       g.105270
 CTGGAAGGTACAGACAGTGGGACATACACTTGTTCTGCCACAAATAAGGCAGGGCACAAC       c.18000
 L  E  G  T  D  S  G  T  Y  T  C  S  A  T  N  K  A  G  H  N         p.6000

          .         .         | 63         .         .         .    g.105463
 CAATGCAGTGGGCATCTGACAGTCAAAG | AACCCCCTTACTTTGTGGAAAAGCCACAGTCA    c.18060
 Q  C  S  G  H  L  T  V  K  E |   P  P  Y  F  V  E  K  P  Q  S      p.6020

          .         .         .         .         .         .       g.105523
 CAAGATGTCAATCCCAACACAAGGGTACAGTTAAAGGCTCTTGTGGGTGGCACTGCACCC       c.18120
 Q  D  V  N  P  N  T  R  V  Q  L  K  A  L  V  G  G  T  A  P         p.6040

          .         .         .         .         .         .       g.105583
 ATGACAATAAAGTGGTTTAAAGATAACAAAGAGTTACACTCAGGAGCAGCCCGCTCAGTT       c.18180
 M  T  I  K  W  F  K  D  N  K  E  L  H  S  G  A  A  R  S  V         p.6060

          .         .         .         .         .         .       g.105643
 TGGAAGGATGACACCTCTACCAGTCTAGAGCTCTTTGCAGCCAAAGCTACCGATTCTGGA       c.18240
 W  K  D  D  T  S  T  S  L  E  L  F  A  A  K  A  T  D  S  G         p.6080

          .         .         .         .         .         .       g.105703
 ACCTACATTTGCCAACTAAGCAATGATGTTGGCACAGCAACCAGCAAAGCCACTCTCTTT       c.18300
 T  Y  I  C  Q  L  S  N  D  V  G  T  A  T  S  K  A  T  L  F         p.6100

         | 64.         .         .         .         .         .    g.105910
 GTAAAAG | AACCTCCTCAATTCATTAAGAAGCCCAGTCCAGTCTTAGTGCTGAGGAATGGA    c.18360
 V  K  E |   P  P  Q  F  I  K  K  P  S  P  V  L  V  L  R  N  G      p.6120

          .         .         .         .         .         .       g.105970
 CAGTCAACAACATTTGAATGCCAAATAACAGGCACTCCTAAAATCCGAGTGTCTTGGTAT       c.18420
 Q  S  T  T  F  E  C  Q  I  T  G  T  P  K  I  R  V  S  W  Y         p.6140

          .         .         .         .         .         .       g.106030
 CTAGACGGGAATGAAATAACAGCCATTCAGAAACATGGCATTTCCTTCATTGATGGTTTA       c.18480
 L  D  G  N  E  I  T  A  I  Q  K  H  G  I  S  F  I  D  G  L         p.6160

          .         .         .         .         .         .       g.106090
 GCCACTTTCCAGATTTCTGGTGCCAGGGTAGAAAATAGTGGGACTTATGTGTGTGAAGCT       c.18540
 A  T  F  Q  I  S  G  A  R  V  E  N  S  G  T  Y  V  C  E  A         p.6180

          .         .         .         .          | 65        .    g.106247
 CGAAATGACGCAGGCACGGCGAGCTGCAGCATTGAACTCAAAGTGAAAG | AACCCCCCACC    c.18600
 R  N  D  A  G  T  A  S  C  S  I  E  L  K  V  K  E |   P  P  T      p.6200

          .         .         .         .         .         .       g.106307
 TTTATCAGAGAGCTGAAGCCTGTGGAGGTAGTAAAATATAGTGACGTGGAGCTGGAGTGT       c.18660
 F  I  R  E  L  K  P  V  E  V  V  K  Y  S  D  V  E  L  E  C         p.6220

          .         .         .         .         .         .       g.106367
 GAAGTTACGGGAACACCTCCGTTTGAAGTCACTTGGCTGAAGAATAACAGGGAAATTCGA       c.18720
 E  V  T  G  T  P  P  F  E  V  T  W  L  K  N  N  R  E  I  R         p.6240

          .         .         .         .         .         .       g.106427
 AGCAGCAAAAAATACACATTGACCGACAGAGTGTCTGTGTTTAACCTCCATATAACCAAG       c.18780
 S  S  K  K  Y  T  L  T  D  R  V  S  V  F  N  L  H  I  T  K         p.6260

          .         .         .         .         .         .       g.106487
 TGTGACCCTTCAGACACTGGGGAATACCAGTGCATTGTATCCAATGAAGGCGGCAGCTGC       c.18840
 C  D  P  S  D  T  G  E  Y  Q  C  I  V  S  N  E  G  G  S  C         p.6280

          .         .         | 66         .         .         .    g.106665
 TCATGCAGTACTAGAGTTGCCCTGAAAG | AACCACCATCATTCATTAAGAAGATAGAAAAT    c.18900
 S  C  S  T  R  V  A  L  K  E |   P  P  S  F  I  K  K  I  E  N      p.6300

          .         .         .         .         .         .       g.106725
 ACCACTACTGTTTTGAAAAGTTCTGCCACCTTTCAGAGTACCGTGGCAGGTTCTCCTCCT       c.18960
 T  T  T  V  L  K  S  S  A  T  F  Q  S  T  V  A  G  S  P  P         p.6320

          .         .         .         .         .         .       g.106785
 ATTTCTATAACCTGGCTAAAGGATGATCAGATTCTTGATGAAGATGATAATGTCTATATT       c.19020
 I  S  I  T  W  L  K  D  D  Q  I  L  D  E  D  D  N  V  Y  I         p.6340

          .         .         .         .         .         .       g.106845
 TCATTTGTGGACAGTGTGGCCACACTTCAAATCAGAAGTGTGGATAATGGACACAGTGGG       c.19080
 S  F  V  D  S  V  A  T  L  Q  I  R  S  V  D  N  G  H  S  G         p.6360

          .         .         .         .         .         .       g.106905
 AGATATACCTGTCAAGCCAAGAATGAGTCAGGAGTTGAGAGGTGTTATGCTTTCCTTTTA       c.19140
 R  Y  T  C  Q  A  K  N  E  S  G  V  E  R  C  Y  A  F  L  L         p.6380

         | 67.         .         .         .         .         .    g.107077
 GTACAAG | AACCAGCTCAAATCGTAGAGAAAGCTAAATCAGTTGATGTTACGGAGAAAGAT    c.19200
 V  Q  E |   P  A  Q  I  V  E  K  A  K  S  V  D  V  T  E  K  D      p.6400

          .         .         .         .         .         .       g.107137
 CCCATGACCTTGGAATGTGTTGTGGCTGGAACACCAGAACTCAAAGTGAAATGGCTTAAA       c.19260
 P  M  T  L  E  C  V  V  A  G  T  P  E  L  K  V  K  W  L  K         p.6420

          .         .         .         .         .         .       g.107197
 GACGGGAAACAAATAGTTCCCAGTAGATACTTTTCAATGAGTTTTGAAAATAACGTGGCC       c.19320
 D  G  K  Q  I  V  P  S  R  Y  F  S  M  S  F  E  N  N  V  A         p.6440

          .         .         .         .         .         .       g.107257
 AGTTTTAGAATTCAGTCAGTAATGAAGCAGGACAGCGGTCAGTACACTTTCAAGGTGGAA       c.19380
 S  F  R  I  Q  S  V  M  K  Q  D  S  G  Q  Y  T  F  K  V  E         p.6460

          .         .         .         .       | 68 .         .    g.107419
 AATGACTTCGGAAGCAGTAGCTGTGATGCCTACTTAAGAGTGCTAG | ATCAAAATATTCCT    c.19440
 N  D  F  G  S  S  S  C  D  A  Y  L  R  V  L  D |   Q  N  I  P      p.6480

          .         .         .         .         .         .       g.107479
 CCATCATTCACCAAAAAATTAACCAAAATGGATAAAGTTCTGGGCTCTTCTATTCATATG       c.19500
 P  S  F  T  K  K  L  T  K  M  D  K  V  L  G  S  S  I  H  M         p.6500

          .         .         .         .         .         .       g.107539
 GAGTGCAAGGTGTCTGGTTCACTTCCCATTAGTGCTCAGTGGTTTAAGGATGGAAAAGAA       c.19560
 E  C  K  V  S  G  S  L  P  I  S  A  Q  W  F  K  D  G  K  E         p.6520

          .         .         .         .         .         .       g.107599
 ATATCTACAAGTGCAAAATACAGACTTGTGTGCCATGAGAGATCTGTGTCTCTGGAAGTT       c.19620
 I  S  T  S  A  K  Y  R  L  V  C  H  E  R  S  V  S  L  E  V         p.6540

          .         .         .         .         .         .       g.107659
 AATAATCTGGAATTAGAAGATACTGCAAATTACACATGCAAAGTGTCAAATGTAGCAGGA       c.19680
 N  N  L  E  L  E  D  T  A  N  Y  T  C  K  V  S  N  V  A  G         p.6560

          .         .         .     | 69   .         .         .    g.107965
 GATGATGCATGCAGTGGCATCTTAACTGTGAAAG | AACCACCAAGCTTCCTAGTGAAACCT    c.19740
 D  D  A  C  S  G  I  L  T  V  K  E |   P  P  S  F  L  V  K  P      p.6580

          .         .         .         .         .         .       g.108025
 GGGCGACAGCAAGCCATACCTGATTCTACAGTGGAATTTAAGGCAATACTAAAAGGAACA       c.19800
 G  R  Q  Q  A  I  P  D  S  T  V  E  F  K  A  I  L  K  G  T         p.6600

          .         .         .         .         .         .       g.108085
 CCACCATTTAAAATAAAATGGTTTAAGGATGATGTGGAACTTGTCTCAGGTCCTAAATGT       c.19860
 P  P  F  K  I  K  W  F  K  D  D  V  E  L  V  S  G  P  K  C         p.6620

          .         .         .         .         .         .       g.108145
 TTCATTGGCTTGGAAGGGTCGACTAGCTTCTTAAATCTCTACTCAGTGGATGCTTCTAAG       c.19920
 F  I  G  L  E  G  S  T  S  F  L  N  L  Y  S  V  D  A  S  K         p.6640

          .         .         .         .         .         .       g.108205
 ACTGGACAGTATACTTGCCATGTTACCAATGATGTTGGTAGCGACTCTTGTACTACGATG       c.19980
 T  G  Q  Y  T  C  H  V  T  N  D  V  G  S  D  S  C  T  T  M         p.6660

          .    | 70    .         .         .         .         .    g.108478
 TTGCTTGTGACAG | AACCACCAAAGTTTGTAAAGAAATTAGAAGCCTCCAAAATTGTGAAA    c.20040
 L  L  V  T  E |   P  P  K  F  V  K  K  L  E  A  S  K  I  V  K      p.6680

          .         .         .         .         .         .       g.108538
 GCAGGTGACTCTTCACGACTTGAATGCAAGATAGCTGGATCCCCAGAAATCAGAGTTGTG       c.20100
 A  G  D  S  S  R  L  E  C  K  I  A  G  S  P  E  I  R  V  V         p.6700

          .         .         .         .         .         .       g.108598
 TGGTTCCGAAATGAACATGAACTTCCAGCCAGTGATAAGTACAGAATGACTTTCATTGAC       c.20160
 W  F  R  N  E  H  E  L  P  A  S  D  K  Y  R  M  T  F  I  D         p.6720

          .         .         .         .         .         .       g.108658
 TCAGTGGCCGTCATACAGATGAACAATCTCAGTACTGAGGACAGTGGAGATTTCATTTGT       c.20220
 S  V  A  V  I  Q  M  N  N  L  S  T  E  D  S  G  D  F  I  C         p.6740

          .         .         .         .         .      | 71  .    g.109761
 GAGGCTCAGAATCCCGCTGGCAGCACAAGCTGCAGTACCAAGGTTATAGTAAAAG | AGCCA    c.20280
 E  A  Q  N  P  A  G  S  T  S  C  S  T  K  V  I  V  K  E |   P      p.6760

          .         .         .         .         .         .       g.109821
 CCTGTTTTTAGCAGCTTCCCTCCTATAGTAGAAACCCTTAAAAATGCTGAAGTCAGTCTT       c.20340
 P  V  F  S  S  F  P  P  I  V  E  T  L  K  N  A  E  V  S  L         p.6780

          .         .         .         .         .         .       g.109881
 GAATGTGAACTTTCGGGAACACCACCGTTTGAGGTGGTATGGTACAAAGACAAGCGGCAA       c.20400
 E  C  E  L  S  G  T  P  P  F  E  V  V  W  Y  K  D  K  R  Q         p.6800

          .         .         .         .         .         .       g.109941
 CTCAGAAGCAGCAAGAAATACAAGATTGCATCCAAAAACTTCCACACAAGTATTCACATT       c.20460
 L  R  S  S  K  K  Y  K  I  A  S  K  N  F  H  T  S  I  H  I         p.6820

          .         .         .         .         .         .       g.110001
 CTCAATGTGGACACTTCAGACATCGGTGAATACCACTGCAAAGCACAGAATGAAGTGGGA       c.20520
 L  N  V  D  T  S  D  I  G  E  Y  H  C  K  A  Q  N  E  V  G         p.6840

          .         .         .     | 72   .         .         .    g.110179
 AGTGATACTTGTGTTTGTACTGTAAAATTGAAAG | AACCACCAAGATTTGTCTCCAAACTG    c.20580
 S  D  T  C  V  C  T  V  K  L  K  E |   P  P  R  F  V  S  K  L      p.6860

          .         .         .         .         .         .       g.110239
 AACAGCCTCACTGTTGTAGCCGGAGAGCCTGCTGAATTACAAGCATCCATAGAAGGCGCC       c.20640
 N  S  L  T  V  V  A  G  E  P  A  E  L  Q  A  S  I  E  G  A         p.6880

          .         .         .         .         .         .       g.110299
 CAGCCTATTTTTGTCCAGTGGCTTAAAGAGAAGGAAGAAGTGATTAGAGAAAGTGAAAAC       c.20700
 Q  P  I  F  V  Q  W  L  K  E  K  E  E  V  I  R  E  S  E  N         p.6900

          .         .         .         .         .         .       g.110359
 ATCAGGATTACATTTGTGGAAAATGTTGCAACTCTACAGTTTGCAAAAGCAGAGCCAGCT       c.20760
 I  R  I  T  F  V  E  N  V  A  T  L  Q  F  A  K  A  E  P  A         p.6920

          .         .         .         .         .         .       g.110419
 AATGCTGGAAAGTATATCTGCCAAATCAAGAATGATGGTGGAATGAGGGAGAACATGGCC       c.20820
 N  A  G  K  Y  I  C  Q  I  K  N  D  G  G  M  R  E  N  M  A         p.6940

          .       | 73 .         .         .         .         .    g.111308
 ACACTGATGGTCTTAG | AGCCCGCAGTCATTGTTGAGAAGGCAGGACCGATGACGGTGACT    c.20880
 T  L  M  V  L  E |   P  A  V  I  V  E  K  A  G  P  M  T  V  T      p.6960

          .         .         .         .         .         .       g.111368
 GTAGGAGAAACGTGCACTCTGGAGTGTAAGGTGGCTGGCACTCCGGAACTCTCTGTTGAA       c.20940
 V  G  E  T  C  T  L  E  C  K  V  A  G  T  P  E  L  S  V  E         p.6980

          .         .         .         .         .         .       g.111428
 TGGTACAAGGATGGAAAGCTGTTGACCAGCAGCCAAAAACACAAATTTAGCTTCTACAAC       c.21000
 W  Y  K  D  G  K  L  L  T  S  S  Q  K  H  K  F  S  F  Y  N         p.7000

          .         .         .         .         .         .       g.111488
 AAAATCTCTTCCTTAAGGATTCTCTCAGTTGAAAGGCAAGATGCAGGCACATACACTTTC       c.21060
 K  I  S  S  L  R  I  L  S  V  E  R  Q  D  A  G  T  Y  T  F         p.7020

          .         .         .         .         .      | 74  .    g.111664
 CAGGTTCAAAATAATGTTGGGAAAAGCAGCTGCACAGCTGTGGTTGATGTTTCAG | ACCGA    c.21120
 Q  V  Q  N  N  V  G  K  S  S  C  T  A  V  V  D  V  S  D |   R      p.7040

          .         .         .         .         .         .       g.111724
 GCAGTTCCTCCCTCTTTCACACGAAGACTGAAAAATACTGGTGGGGTGTTAGGTGCTTCT       c.21180
 A  V  P  P  S  F  T  R  R  L  K  N  T  G  G  V  L  G  A  S         p.7060

          .         .         .         .         .         .       g.111784
 TGCATCTTGGAATGCAAAGTAGCTGGATCATCACCTATTTCAGTTGCCTGGTTTCATGAG       c.21240
 C  I  L  E  C  K  V  A  G  S  S  P  I  S  V  A  W  F  H  E         p.7080

          .         .         .         .         .         .       g.111844
 AAAACCAAGATTGTCAGTGGAGCAAAGTACCAAACCACATTTTCAGATAATGTCTGCACA       c.21300
 K  T  K  I  V  S  G  A  K  Y  Q  T  T  F  S  D  N  V  C  T         p.7100

          .         .         .         .         .         .       g.111904
 TTGCAGTTGAATTCTCTGGATTCCTCAGATATGGGCAATTACACATGCGTGGCTGCTAAT       c.21360
 L  Q  L  N  S  L  D  S  S  D  M  G  N  Y  T  C  V  A  A  N         p.7120

          .         .         .         .    | 75    .         .    g.112123
 GTCGCTGGGTCTGATGAATGTCGTGCAGTGCTAACTGTACAAG | AACCACCCTCTTTTGTG    c.21420
 V  A  G  S  D  E  C  R  A  V  L  T  V  Q  E |   P  P  S  F  V      p.7140

          .         .         .         .         .         .       g.112183
 AAAGAACCTGAACCTTTGGAAGTACTACCAGGCAAAAATGTAACCTTCACAAGCGTTATT       c.21480
 K  E  P  E  P  L  E  V  L  P  G  K  N  V  T  F  T  S  V  I         p.7160

          .         .         .         .         .         .       g.112243
 AGAGGAACCCCTCCATTCAAAGTCAACTGGTTCAGAGGTGCCAGAGAACTAGTGAAAGGA       c.21540
 R  G  T  P  P  F  K  V  N  W  F  R  G  A  R  E  L  V  K  G         p.7180

          .         .         .         .         .         .       g.112303
 GACCGGTGCAACATCTATTTTGAAGACACTGTGGCAGAACTGGAATTATTTAATATTGAC       c.21600
 D  R  C  N  I  Y  F  E  D  T  V  A  E  L  E  L  F  N  I  D         p.7200

          .         .         .         .         .         .       g.112363
 ATATCTCAGAGTGGGGAATACACCTGTGTGGTTTCTAACAACGCTGGCCAAGCATCTTGC       c.21660
 I  S  Q  S  G  E  Y  T  C  V  V  S  N  N  A  G  Q  A  S  C         p.7220

          .         .   | 76     .         .         .         .    g.112516
 ACTACCCGTCTCTTTGTGAAAG | AACCAGCTGCATTTTTGAAGAGATTAAGTGATCATTCT    c.21720
 T  T  R  L  F  V  K  E |   P  A  A  F  L  K  R  L  S  D  H  S      p.7240

          .         .         .         .         .         .       g.112576
 GTAGAACCAGGGAAGTCCATAATTCTGGAGAGCACCTACACTGGAACACTTCCAATTTCT       c.21780
 V  E  P  G  K  S  I  I  L  E  S  T  Y  T  G  T  L  P  I  S         p.7260

          .         .         .         .         .         .       g.112636
 GTCACTTGGAAAAAGGATGGTTTTAACATAACTACCTCTGAAAAATGTAACATAGTCACA       c.21840
 V  T  W  K  K  D  G  F  N  I  T  T  S  E  K  C  N  I  V  T         p.7280

          .         .         .         .         .         .       g.112696
 ACAGAGAAAACTTGTATCCTGGAAATTCTGAATAGCACAAAAAGAGATGCAGGGCAGTAT       c.21900
 T  E  K  T  C  I  L  E  I  L  N  S  T  K  R  D  A  G  Q  Y         p.7300

          .         .         .         .         .         .       g.112756
 TCCTGCGAGATTGAAAATGAGGCAGGAAGGGATGTTTGTGGAGCTCTGGTATCTACATTA       c.21960
 S  C  E  I  E  N  E  A  G  R  D  V  C  G  A  L  V  S  T  L         p.7320

   | 77      .         .         .         .         .         .    g.112924
 G | AACCGCCTTATTTTGTTACGGAACTGGAACCTCTGGAGGCAGCAGTTGGAGATTCGGTT    c.22020
 E |   P  P  Y  F  V  T  E  L  E  P  L  E  A  A  V  G  D  S  V      p.7340

          .         .         .         .         .         .       g.112984
 TCTTTACAATGCCAAGTTGCTGGGACACCAGAAATTACAGTGTCTTGGTACAAAGGAGAT       c.22080
 S  L  Q  C  Q  V  A  G  T  P  E  I  T  V  S  W  Y  K  G  D         p.7360

          .         .         .         .         .         .       g.113044
 ACCAAATTACGGCCAACTCCTGAATACAGGACCTACTTTACAAACAATGTGGCCACACTT       c.22140
 T  K  L  R  P  T  P  E  Y  R  T  Y  F  T  N  N  V  A  T  L         p.7380

          .         .         .         .         .         .       g.113104
 GTTTTTAATAAAGTGAACATCAATGACAGTGGAGAGTACACATGCAAAGCAGAAAATAGT       c.22200
 V  F  N  K  V  N  I  N  D  S  G  E  Y  T  C  K  A  E  N  S         p.7400

          .         .         .         . | 78       .         .    g.113276
 ATAGGAACTGCTTCTTCTAAGACTGTGTTCAGAATTCAAG | AGCGCCAACTCCCACCTTCT    c.22260
 I  G  T  A  S  S  K  T  V  F  R  I  Q  E |   R  Q  L  P  P  S      p.7420

          .         .         .         .         .         .       g.113336
 TTTGCAAGACAATTAAAGGACATTGAACAAACTGTGGGGTTACCTGTTACACTCACTTGT       c.22320
 F  A  R  Q  L  K  D  I  E  Q  T  V  G  L  P  V  T  L  T  C         p.7440

          .         .         .         .         .         .       g.113396
 CGATTAAATGGCTCTGCACCCATCCAAGTGTGCTGGTATAGAGATGGAGTACTTTTAAGA       c.22380
 R  L  N  G  S  A  P  I  Q  V  C  W  Y  R  D  G  V  L  L  R         p.7460

          .         .         .         .         .         .       g.113456
 GACGATGAAAATCTACAGACTTCATTTGTAGATAATGTGGCAACTTTAAAAATTTTGCAA       c.22440
 D  D  E  N  L  Q  T  S  F  V  D  N  V  A  T  L  K  I  L  Q         p.7480

          .         .         .         .         .         .       g.113516
 ACTGACTTGAGTCACTCTGGCCAGTACTCTTGCTCAGCTTCCAACCCACTTGGAACAGCA       c.22500
 T  D  L  S  H  S  G  Q  Y  S  C  S  A  S  N  P  L  G  T  A         p.7500

          .         .         | 79         .         .         .    g.113700
 TCTTCTAGTGCTAGACTCACAGCAAGAG | AACCCAAGAAATCTCCCTTCTTTGACATCAAG    c.22560
 S  S  S  A  R  L  T  A  R  E |   P  K  K  S  P  F  F  D  I  K      p.7520

          .         .         .         .         .         .       g.113760
 CCTGTATCTATAGATGTTATTGCTGGAGAAAGTGCTGATTTTGAGTGTCATGTTACTGGT       c.22620
 P  V  S  I  D  V  I  A  G  E  S  A  D  F  E  C  H  V  T  G         p.7540

          .         .         .         .         .         .       g.113820
 GCTCAACCGATGCGAATCACTTGGTCAAAAGATAACAAGGAGATCCGTCCTGGAGGAAAC       c.22680
 A  Q  P  M  R  I  T  W  S  K  D  N  K  E  I  R  P  G  G  N         p.7560

          .         .         .         .         .         .       g.113880
 TATACAATCACATGTGTGGGAAACACTCCTCATTTGAGAATTCTTAAAGTAGGCAAAGGA       c.22740
 Y  T  I  T  C  V  G  N  T  P  H  L  R  I  L  K  V  G  K  G         p.7580

          .         .         .         .         .         .       g.113940
 GACTCTGGTCAATATACTTGCCAAGCAACCAATGATGTTGGCAAAGACATGTGCTCAGCT       c.22800
 D  S  G  Q  Y  T  C  Q  A  T  N  D  V  G  K  D  M  C  S  A         p.7600

          .       | 80 .         .         .         .         .    g.114644
 CAGCTCAGTGTAAAAG | AACCTCCAAAGTTTGTTAAGAAATTAGAAGCTTCAAAAGTTGCA    c.22860
 Q  L  S  V  K  E |   P  P  K  F  V  K  K  L  E  A  S  K  V  A      p.7620

          .         .         .         .         .         .       g.114704
 AAGCAGGGAGAATCCATTCAACTGGAATGTAAAATAAGTGGCTCCCCAGAAATCAAAGTT       c.22920
 K  Q  G  E  S  I  Q  L  E  C  K  I  S  G  S  P  E  I  K  V         p.7640

          .         .         .         .         .         .       g.114764
 TCATGGTTCCGAAATGACAGCGAACTTCATGAAAGTTGGAAATACAACATGTCATTCATT       c.22980
 S  W  F  R  N  D  S  E  L  H  E  S  W  K  Y  N  M  S  F  I         p.7660

          .         .         .         .         .         .       g.114824
 AATTCTGTGGCATTGCTTACGATCAATGAAGCTAGTGCTGAAGACAGCGGGGACTACATT       c.23040
 N  S  V  A  L  L  T  I  N  E  A  S  A  E  D  S  G  D  Y  I         p.7680

          .         .         .         .         .         | 81    g.115141
 TGTGAGGCTCATAATGGTGTTGGTGACGCCAGCTGCAGCACAGCGTTGACAGTGAAAG | CA    c.23100
 C  E  A  H  N  G  V  G  D  A  S  C  S  T  A  L  T  V  K  A |       p.7700

          .         .         .         .         .         .       g.115201
 CCTCCTGTTTTCACCCAGAAGCCTTCTCCAGTAGGAGCTCTTAAAGGTTCTGATGTGATT       c.23160
 P  P  V  F  T  Q  K  P  S  P  V  G  A  L  K  G  S  D  V  I         p.7720

          .         .         .         .         .         .       g.115261
 CTCCAATGTGAAATTTCGGGAACTCCCCCATTTGAAGTAGTATGGGTTAAAGATCGAAAG       c.23220
 L  Q  C  E  I  S  G  T  P  P  F  E  V  V  W  V  K  D  R  K         p.7740

          .         .         .         .         .         .       g.115321
 CAGGTTAGAAACAGCAAGAAATTTAAAATCACTTCAAAACATTTTGATACAAGTCTTCAT       c.23280
 Q  V  R  N  S  K  K  F  K  I  T  S  K  H  F  D  T  S  L  H         p.7760

          .         .         .         .         .         .       g.115381
 ATCCTTAATCTTGAAGCCTCCGATGTCGGGGAATATCACTGCAAAGCTACTAATGAGGTG       c.23340
 I  L  N  L  E  A  S  D  V  G  E  Y  H  C  K  A  T  N  E  V         p.7780

          .         .         .        | 82.         .         .    g.115561
 GGAAGTGACACGTGTTCTTGCTCTGTCAAGTTCAAAG | AACCTCCACGATTCGTGAAAAAG    c.23400
 G  S  D  T  C  S  C  S  V  K  F  K  E |   P  P  R  F  V  K  K      p.7800

          .         .         .         .         .         .       g.115621
 CTAAGTGACACCTCAACCCTTATTGGGGATGCTGTTGAGTTACGGGCCATAGTGGAGGGC       c.23460
 L  S  D  T  S  T  L  I  G  D  A  V  E  L  R  A  I  V  E  G         p.7820

          .         .         .         .         .         .       g.115681
 TTCCAGCCAATTTCTGTTGTCTGGCTGAAAGATAGAGGTGAAGTCATCAGAGAGAGTGAA       c.23520
 F  Q  P  I  S  V  V  W  L  K  D  R  G  E  V  I  R  E  S  E         p.7840

          .         .         .         .         .         .       g.115741
 AATACCAGGATTTCATTCATTGATAACATTGCAACCCTCCAGCTGGGGAGTCCAGAAGCA       c.23580
 N  T  R  I  S  F  I  D  N  I  A  T  L  Q  L  G  S  P  E  A         p.7860

          .         .         .         .         .         .       g.115801
 TCTAATTCTGGAAAATATATATGCCAAATCAAAAACGATGCTGGAATGAGAGAATGCTCT       c.23640
 S  N  S  G  K  Y  I  C  Q  I  K  N  D  A  G  M  R  E  C  S         p.7880

          .          | 83        .         .         .         .    g.116011
 GCAGTCTTGACTGTACTAG | AACCAGCAAGAATCATAGAGAAGCCCGAACCCATGACTGTC    c.23700
 A  V  L  T  V  L  E |   P  A  R  I  I  E  K  P  E  P  M  T  V      p.7900

          .         .         .         .         .         .       g.116071
 ACTACTGGAAATCCTTTTGCATTAGAGTGTGTAGTGACTGGAACACCAGAACTCTCAGCC       c.23760
 T  T  G  N  P  F  A  L  E  C  V  V  T  G  T  P  E  L  S  A         p.7920

          .         .         .         .         .         .       g.116131
 AAGTGGTTCAAAGATGGAAGAGAATTGTCTGCAGACAGCAAACATCACATTACATTCATC       c.23820
 K  W  F  K  D  G  R  E  L  S  A  D  S  K  H  H  I  T  F  I         p.7940

          .         .         .         .         .         .       g.116191
 AATAAAGTGGCTTCCCTTAAAATCCCCTGTGCCGAAATGAGTGACAAAGGATTATATAGC       c.23880
 N  K  V  A  S  L  K  I  P  C  A  E  M  S  D  K  G  L  Y  S         p.7960

          .         .         .         .         .         | 84    g.116353
 TTTGAAGTGAAAAACAGTGTTGGCAAAAGTAACTGCACTGTATCCGTCCATGTTTCTG | AT    c.23940
 F  E  V  K  N  S  V  G  K  S  N  C  T  V  S  V  H  V  S  D |       p.7980

          .         .         .         .         .         .       g.116413
 CGGATTGTGCCTCCTTCCTTCATCCGCAAGCTGAAAGACGTGAATGCCATCCTGGGGGCC       c.24000
 R  I  V  P  P  S  F  I  R  K  L  K  D  V  N  A  I  L  G  A         p.8000

          .         .         .         .         .         .       g.116473
 TCAGTTGTTTTGGAGTGCCGAGTCTCTGGCTCAGCCCCGATTTCAGTTGGCTGGTTTCAG       c.24060
 S  V  V  L  E  C  R  V  S  G  S  A  P  I  S  V  G  W  F  Q         p.8020

          .         .         .         .         .         .       g.116533
 GATGGAAATGAGATTGTTAGTGGGCCCAAATGTCAGTCCAGCTTTTCGGAAAACGTCTGT       c.24120
 D  G  N  E  I  V  S  G  P  K  C  Q  S  S  F  S  E  N  V  C         p.8040

          .         .         .         .         .         .       g.116593
 ACTTTGAATCTGAGCTTGTTGGAGCCCTCCGACACAGGCATATACACGTGTGTGGCTGCC       c.24180
 T  L  N  L  S  L  L  E  P  S  D  T  G  I  Y  T  C  V  A  A         p.8060

          .         .         .         .       | 85 .         .    g.116843
 AATGTAGCTGGTTCCGATGAGTGCTCAGCAGTCCTGACTGTGCAAG | AACCACCATCTTTT    c.24240
 N  V  A  G  S  D  E  C  S  A  V  L  T  V  Q  E |   P  P  S  F      p.8080

          .         .         .         .         .         .       g.116903
 GAACAAACCCCTGATTCTGTGGAAGTTTTGCCTGGAATGAGCCTCACATTCACCAGTGTC       c.24300
 E  Q  T  P  D  S  V  E  V  L  P  G  M  S  L  T  F  T  S  V         p.8100

          .         .         .         .         .         .       g.116963
 ATCAGAGGCACCCCTCCTTTCAAGGTCAAGTGGTTTAAAGGCAGCAGGGAACTGGTGCCT       c.24360
 I  R  G  T  P  P  F  K  V  K  W  F  K  G  S  R  E  L  V  P         p.8120

          .         .         .         .         .         .       g.117023
 GGGGAGTCATGCAACATCTCTCTGGAAGATTTTGTCACAGAACTGGAGTTGTTTGAGGTG       c.24420
 G  E  S  C  N  I  S  L  E  D  F  V  T  E  L  E  L  F  E  V         p.8140

          .         .         .         .         .         .       g.117083
 CAGCCATTAGAAAGTGGAGACTATTCTTGCCTCGTTACAAATGATGCTGGCAGTGCTTCC       c.24480
 Q  P  L  E  S  G  D  Y  S  C  L  V  T  N  D  A  G  S  A  S         p.8160

          .         .      | 86  .         .         .         .    g.117237
 TGTACCACACATCTTTTTGTGAAAG | AACCAGCCACCTTTGTGAAAAGATTGGCTGATTTC    c.24540
 C  T  T  H  L  F  V  K  E |   P  A  T  F  V  K  R  L  A  D  F      p.8180

          .         .         .         .         .         .       g.117297
 AGTGTTGAGACAGGAAGCCCCATAGTTCTCGAGGCCACATACACTGGCACACCTCCAATC       c.24600
 S  V  E  T  G  S  P  I  V  L  E  A  T  Y  T  G  T  P  P  I         p.8200

          .         .         .         .         .         .       g.117357
 TCAGTGAGCTGGATAAAGGACGAGTATCTTATTTCACAATCTGAGAGATGCAGTATTACT       c.24660
 S  V  S  W  I  K  D  E  Y  L  I  S  Q  S  E  R  C  S  I  T         p.8220

          .         .         .         .         .         .       g.117417
 ATGACAGAAAAATCTACCATACTGGAAATTCTTGAGAGCACAATAGAGGATTATGCACAG       c.24720
 M  T  E  K  S  T  I  L  E  I  L  E  S  T  I  E  D  Y  A  Q         p.8240

          .         .         .         .         .         .       g.117477
 TACAGCTGCCTGATAGAAAATGAGGCTGGTCAAGATATCTGTGAAGCTCTGGTGTCTGTC       c.24780
 Y  S  C  L  I  E  N  E  A  G  Q  D  I  C  E  A  L  V  S  V         p.8260

      | 87   .         .         .         .         .         .    g.117637
 TTAG | AACCACCGTACTTTATTGAACCTCTGGAACATGTGGAAGCAGTCATTGGAGAACCT    c.24840
 L  E |   P  P  Y  F  I  E  P  L  E  H  V  E  A  V  I  G  E  P      p.8280

          .         .         .         .         .         .       g.117697
 GCAACTTTACAGTGTAAAGTGGATGGAACTCCAGAAATTAGAATTTCTTGGTATAAAGAA       c.24900
 A  T  L  Q  C  K  V  D  G  T  P  E  I  R  I  S  W  Y  K  E         p.8300

          .         .         .         .         .         .       g.117757
 CACACAAAGCTACGATCAGCTCCTGCATATAAAATGCAATTCAAAAATAACGTTGCTTCC       c.24960
 H  T  K  L  R  S  A  P  A  Y  K  M  Q  F  K  N  N  V  A  S         p.8320

          .         .         .         .         .         .       g.117817
 TTAGTAATCAACAAAGTGGATCACAGTGATGTGGGAGAGTATTCATGCAAGGCAGACAAC       c.25020
 L  V  I  N  K  V  D  H  S  D  V  G  E  Y  S  C  K  A  D  N         p.8340

          .         .         .         .    | 88    .         .    g.118009
 AGTGTGGGGGCAGTCGCTTCTTCAGCTGTGCTTGTTATCAAAG | CGCGCAAACTTCCACCT    c.25080
 S  V  G  A  V  A  S  S  A  V  L  V  I  K  A |   R  K  L  P  P      p.8360

          .         .         .         .         .         .       g.118069
 TTCTTTGCAAGAAAACTGAAAGACGTTCATGAGACTCTAGGCTTCCCAGTTGCATTTGAA       c.25140
 F  F  A  R  K  L  K  D  V  H  E  T  L  G  F  P  V  A  F  E         p.8380

          .         .         .         .         .         .       g.118129
 TGCCGCATCAATGGCTCAGAACCTCTTCAAGTGTCTTGGTACAAGGATGGGGTTCTTTTG       c.25200
 C  R  I  N  G  S  E  P  L  Q  V  S  W  Y  K  D  G  V  L  L         p.8400

          .         .         .         .         .         .       g.118189
 AAAGATGATGCTAATTTGCAGACATCTTTTGTTCATAATGTAGCAACTCTTCAGATTTTA       c.25260
 K  D  D  A  N  L  Q  T  S  F  V  H  N  V  A  T  L  Q  I  L         p.8420

          .         .         .         .         .         .       g.118249
 CAAACTGACCAGAGCCACATAGGGCAGTATAATTGCTCTGCTTCTAATCCTCTTGGGACT       c.25320
 Q  T  D  Q  S  H  I  G  Q  Y  N  C  S  A  S  N  P  L  G  T         p.8440

          .         .         .  | 89      .         .         .    g.118449
 GCTTCATCCAGTGCCAAGCTCATTCTCTCAG | AGCATGAAGTGCCTCCTTTCTTTGATCTA    c.25380
 A  S  S  S  A  K  L  I  L  S  E |   H  E  V  P  P  F  F  D  L      p.8460

          .         .         .         .         .         .       g.118509
 AAGCCTGTATCAGTAGATCTTGCTCTTGGAGAAAGTGGTACTTTTAAATGTCATGTAACT       c.25440
 K  P  V  S  V  D  L  A  L  G  E  S  G  T  F  K  C  H  V  T         p.8480

          .         .         .         .         .         .       g.118569
 GGGACTGCACCAATCAAAATCACTTGGGCCAAAGATAACCGAGAGATTCGCCCTGGAGGC       c.25500
 G  T  A  P  I  K  I  T  W  A  K  D  N  R  E  I  R  P  G  G         p.8500

          .         .         .         .         .         .       g.118629
 AACTACAAGATGACTTTGGTAGAAAATACTGCCACTCTGACAGTTCTCAAAGTAGGCAAA       c.25560
 N  Y  K  M  T  L  V  E  N  T  A  T  L  T  V  L  K  V  G  K         p.8520

          .         .         .         .         .         .       g.118689
 GGCGATGCCGGGCAGTACACCTGCTATGCAAGCAACATCGCTGGAAAAGACTCTTGTTCT       c.25620
 G  D  A  G  Q  Y  T  C  Y  A  S  N  I  A  G  K  D  S  C  S         p.8540

          .          | 90        .         .         .         .    g.120069
 GCTCAGCTGGGTGTACAAG | AACCACCCAGGTTCATTAAGAAGCTAGAACCTTCAAGAATT    c.25680
 A  Q  L  G  V  Q  E |   P  P  R  F  I  K  K  L  E  P  S  R  I      p.8560

          .         .         .         .         .         .       g.120129
 GTGAAACAGGATGAATTCACAAGGTATGAATGCAAAATCGGTGGGTCTCCAGAAATCAAA       c.25740
 V  K  Q  D  E  F  T  R  Y  E  C  K  I  G  G  S  P  E  I  K         p.8580

          .         .         .         .         .         .       g.120189
 GTTTTATGGTATAAGGACGAGACTGAAATTCAAGAGAGCAGTAAATTCAGAATGTCATTC       c.25800
 V  L  W  Y  K  D  E  T  E  I  Q  E  S  S  K  F  R  M  S  F         p.8600

          .         .         .         .         .         .       g.120249
 GTTGACTCGGTGGCTGTGCTGGAAATGCACAATCTCAGTGTTGAAGACAGTGGAGACTAC       c.25860
 V  D  S  V  A  V  L  E  M  H  N  L  S  V  E  D  S  G  D  Y         p.8620

          .         .         .         .         .         .       g.120309
 ACCTGTGAGGCCCACAATGCAGCAGGCAGTGCCAGCAGCAGCACATCCTTAAAAGTTAAA       c.25920
 T  C  E  A  H  N  A  A  G  S  A  S  S  S  T  S  L  K  V  K         p.8640

   | 91      .         .         .         .         .         .    g.120597
 G | AACCACCCATTTTCCGCAAAAAGCCTCATCCTATAGAGACACTGAAAGGAGCTGATGTT    c.25980
 E |   P  P  I  F  R  K  K  P  H  P  I  E  T  L  K  G  A  D  V      p.8660

          .         .         .         .         .         .       g.120657
 CACCTTGAATGTGAGCTTCAGGGCACTCCCCCATTTCACGTTTCTTGGTATAAAGACAAG       c.26040
 H  L  E  C  E  L  Q  G  T  P  P  F  H  V  S  W  Y  K  D  K         p.8680

          .         .         .         .         .         .       g.120717
 AGAGAACTTAGGAGCGGCAAGAAGTACAAGATAATGTCTGAGAACTTCCTAACCAGTATC       c.26100
 R  E  L  R  S  G  K  K  Y  K  I  M  S  E  N  F  L  T  S  I         p.8700

          .         .         .         .         .         .       g.120777
 CACATCCTGAATGTCGATGCTGCAGACATTGGGGAATATCAGTGTAAAGCCACAAATGAT       c.26160
 H  I  L  N  V  D  A  A  D  I  G  E  Y  Q  C  K  A  T  N  D         p.8720

          .         .         .         . | 92       .         .    g.121249
 GTGGGAAGCGACACTTGCGTTGGTTCCATCGCTCTCAAAG | CACCACCAAGATTTGTGAAG    c.26220
 V  G  S  D  T  C  V  G  S  I  A  L  K  A |   P  P  R  F  V  K      p.8740

          .         .         .         .         .         .       g.121309
 AAGCTCAGTGACATATCTACTGTCGTTGGTAAAGAAGTTCAGCTGCAGACTACCATTGAA       c.26280
 K  L  S  D  I  S  T  V  V  G  K  E  V  Q  L  Q  T  T  I  E         p.8760

          .         .         .         .         .         .       g.121369
 GGCGCTGAACCCATTTCAGTGGTGTGGTTCAAAGATAAGGGAGAAATCGTTAGAGAAAGT       c.26340
 G  A  E  P  I  S  V  V  W  F  K  D  K  G  E  I  V  R  E  S         p.8780

          .         .         .         .         .         .       g.121429
 GACAACATATGGATTTCTTATTCAGAAAACATTGCAACCTTACAGTTTTCAAGAGTGGAA       c.26400
 D  N  I  W  I  S  Y  S  E  N  I  A  T  L  Q  F  S  R  V  E         p.8800

          .         .         .         .         .         .       g.121489
 CCAGCCAATGCTGGAAAATACACTTGTCAGATCAAAAACGATGCTGGGATGCAAGAGTGC       c.26460
 P  A  N  A  G  K  Y  T  C  Q  I  K  N  D  A  G  M  Q  E  C         p.8820

          .         .   | 93     .         .         .         .    g.121665
 TTCGCCACGCTATCCGTTCTCG | AGCCTGCAACAATTGTAGAAAAGCCAGAATCCATAAAA    c.26520
 F  A  T  L  S  V  L  E |   P  A  T  I  V  E  K  P  E  S  I  K      p.8840

          .         .         .         .         .         .       g.121725
 GTTACCACGGGAGACACCTGTACCTTGGAGTGTACAGTAGCTGGCACCCCTGAACTCAGT       c.26580
 V  T  T  G  D  T  C  T  L  E  C  T  V  A  G  T  P  E  L  S         p.8860

          .         .         .         .         .         .       g.121785
 ACTAAGTGGTTTAAGGATGGAAAAGAGCTAACAAGTGACAACAAATACAAAATAAGCTTC       c.26640
 T  K  W  F  K  D  G  K  E  L  T  S  D  N  K  Y  K  I  S  F         p.8880

          .         .         .         .         .         .       g.121845
 TTCAACAAAGTATCCGGCCTTAAGATCATCAATGTAGCACCGAGTGACAGTGGGGTATAC       c.26700
 F  N  K  V  S  G  L  K  I  I  N  V  A  P  S  D  S  G  V  Y         p.8900

          .         .         .         .         .         .       g.121905
 AGTTTTGAGGTGCAGAACCCTGTTGGCAAAGACAGCTGCACAGCTTCATTGCAGGTTTCA       c.26760
 S  F  E  V  Q  N  P  V  G  K  D  S  C  T  A  S  L  Q  V  S         p.8920

   | 94      .         .         .         .         .         .    g.122489
 G | ACCGAACCGTTCCTCCTTCATTCACAAGAAAATTGAAAGAGACAAATGGTCTATCCGGC    c.26820
 D |   R  T  V  P  P  S  F  T  R  K  L  K  E  T  N  G  L  S  G      p.8940

          .         .         .         .         .         .       g.122549
 TCCTCAGTTGTAATGGAGTGTAAAGTCTATGGGTCACCTCCAATCTCTGTCTCCTGGTTC       c.26880
 S  S  V  V  M  E  C  K  V  Y  G  S  P  P  I  S  V  S  W  F         p.8960

          .         .         .         .         .         .       g.122609
 CATGAAGGAAATGAGATCAGTAGTGGAAGGAAATACCAGACCACCCTGACAGATAATACT       c.26940
 H  E  G  N  E  I  S  S  G  R  K  Y  Q  T  T  L  T  D  N  T         p.8980

          .         .         .         .         .         .       g.122669
 TGTGCTTTAACTGTGAACATGCTGGAAGAATCAGACAGTGGTGACTACACATGTATAGCT       c.27000
 C  A  L  T  V  N  M  L  E  E  S  D  S  G  D  Y  T  C  I  A         p.9000

          .         .         .         .          | 95        .    g.122838
 ACTAATATGGCTGGTTCTGATGAATGTAGTGCTCCTTTGACTGTGAGAG | AACCACCATCT    c.27060
 T  N  M  A  G  S  D  E  C  S  A  P  L  T  V  R  E |   P  P  S      p.9020

          .         .         .         .         .         .       g.122898
 TTTGTTCAGAAACCTGATCCCATGGATGTTTTAACTGGGACCAATGTAACTTTCACAAGT       c.27120
 F  V  Q  K  P  D  P  M  D  V  L  T  G  T  N  V  T  F  T  S         p.9040

          .         .         .         .         .         .       g.122958
 ATCGTAAAAGGAACACCTCCTTTCAGTGTTAGCTGGTTCAAAGGTAGCAGTGAACTAGTA       c.27180
 I  V  K  G  T  P  P  F  S  V  S  W  F  K  G  S  S  E  L  V         p.9060

          .         .         .         .         .         .       g.123018
 CCAGGTGACAGATGCAACGTGTCTTTGGAGGATTCAGTTGCTGAACTGGAGTTGTTCGAT       c.27240
 P  G  D  R  C  N  V  S  L  E  D  S  V  A  E  L  E  L  F  D         p.9080

          .         .         .         .         .         .       g.123078
 GTAGATACATCACAAAGTGGAGAATATACTTGCATAGTTAGCAATGAAGCTGGCAAGGCT       c.27300
 V  D  T  S  Q  S  G  E  Y  T  C  I  V  S  N  E  A  G  K  A         p.9100

          .         .         | 96         .         .         .    g.123241
 TCTTGTACAACACATCTCTACATAAAAG | CCCCAGCCAAATTTGTGAAGAGGCTGAATGAT    c.27360
 S  C  T  T  H  L  Y  I  K  A |   P  A  K  F  V  K  R  L  N  D      p.9120

          .         .         .         .         .         .       g.123301
 TACAGCATAGAGAAAGGAAAACCCCTGATCCTAGAGGGTACATTCACTGGAACTCCTCCC       c.27420
 Y  S  I  E  K  G  K  P  L  I  L  E  G  T  F  T  G  T  P  P         p.9140

          .         .         .         .         .         .       g.123361
 ATTTCGGTTACCTGGAAGAAAAATGGCATAAATGTAACTCCTTCTCAGAGGTGTAATATA       c.27480
 I  S  V  T  W  K  K  N  G  I  N  V  T  P  S  Q  R  C  N  I         p.9160

          .         .         .         .         .         .       g.123421
 ACTACGACTGAAAAATCGGCAATCCTGGAAATTCCAAGTAGCACAGTAGAGGATGCAGGA       c.27540
 T  T  T  E  K  S  A  I  L  E  I  P  S  S  T  V  E  D  A  G         p.9180

          .         .         .         .         .         .       g.123481
 CAATACAACTGCTACATTGAAAATGCCTCTGGAAAAGATTCCTGTTCAGCACAAATACTC       c.27600
 Q  Y  N  C  Y  I  E  N  A  S  G  K  D  S  C  S  A  Q  I  L         p.9200

         | 97.         .         .         .         .         .    g.123633
 ATACTAG | AACCACCGTATTTTGTCAAGCAGTTGGAGCCGGTTAAGGTGTCTGTTGGAGAT    c.27660
 I  L  E |   P  P  Y  F  V  K  Q  L  E  P  V  K  V  S  V  G  D      p.9220

          .         .         .         .         .         .       g.123693
 TCTGCCTCTCTACAATGCCAGCTTGCTGGAACCCCTGAAATTGGGGTATCCTGGTATAAA       c.27720
 S  A  S  L  Q  C  Q  L  A  G  T  P  E  I  G  V  S  W  Y  K         p.9240

          .         .         .         .         .         .       g.123753
 GGAGATACAAAATTGAGACCCACTACGACTTACAAAATGCATTTTAGGAATAATGTTGCT       c.27780
 G  D  T  K  L  R  P  T  T  T  Y  K  M  H  F  R  N  N  V  A         p.9260

          .         .         .         .         .         .       g.123813
 ACACTGGTTTTCAACCAGGTTGATATTAATGATAGTGGAGAATATATCTGCAAAGCTGAA       c.27840
 T  L  V  F  N  Q  V  D  I  N  D  S  G  E  Y  I  C  K  A  E         p.9280

          .         .         .         .       | 98 .         .    g.124467
 AACAGCGTGGGAGAAGTTTCTGCATCAACTTTCCTTACCGTTCAAG | AGCAAAAACTTCCA    c.27900
 N  S  V  G  E  V  S  A  S  T  F  L  T  V  Q  E |   Q  K  L  P      p.9300

          .         .         .         .         .         .       g.124527
 CCATCATTTTCTCGACAATTGAGAGATGTTCAAGAAACAGTTGGACTGCCAGTTGTTTTT       c.27960
 P  S  F  S  R  Q  L  R  D  V  Q  E  T  V  G  L  P  V  V  F         p.9320

          .         .         .         .         .         .       g.124587
 GATTGTGCCATAAGTGGATCAGAACCTATCTCCGTGTCTTGGTATAAAGACGGCAAGCCA       c.28020
 D  C  A  I  S  G  S  E  P  I  S  V  S  W  Y  K  D  G  K  P         p.9340

          .         .         .         .         .         .       g.124647
 TTGAAAGACAGCCCAAATGTACAAACATCATTTTTAGACAATACAGCCACACTCAATATT       c.28080
 L  K  D  S  P  N  V  Q  T  S  F  L  D  N  T  A  T  L  N  I         p.9360

          .         .         .         .         .         .       g.124707
 TTTAAAACTGACCGGAGCCTTGCAGGCCAGTATTCCTGCACAGCTACAAACCCTATAGGC       c.28140
 F  K  T  D  R  S  L  A  G  Q  Y  S  C  T  A  T  N  P  I  G         p.9380

          .         .         .     | 99   .         .         .    g.124906
 TCTGCTTCTTCCAGTGCCAGGCTCATTCTCACAG | AGGGGAAGAACCCACCCTTCTTTGAC    c.28200
 S  A  S  S  S  A  R  L  I  L  T  E |   G  K  N  P  P  F  F  D      p.9400

          .         .         .         .         .         .       g.124966
 ATCCGTCTTGCCCCTGTGGATGCTGTGGTGGGAGAAAGTGCTGACTTTGAGTGCCACGTC       c.28260
 I  R  L  A  P  V  D  A  V  V  G  E  S  A  D  F  E  C  H  V         p.9420

          .         .         .         .         .         .       g.125026
 ACGGGCACACAACCGATAAAGGTCAGCTGGGCCAAAGACAGCAGAGAAATACGAAGTGGC       c.28320
 T  G  T  Q  P  I  K  V  S  W  A  K  D  S  R  E  I  R  S  G         p.9440

          .         .         .         .         .         .       g.125086
 GGAAAGTACCAGATTAGTTATCTGGAAAACAGCGCCCACCTGACAGTCCTCAAAGTAGAC       c.28380
 G  K  Y  Q  I  S  Y  L  E  N  S  A  H  L  T  V  L  K  V  D         p.9460

          .         .         .         .         .         .       g.125146
 AAAGGAGATTCTGGACAATATACCTGCTATGCTGTGAATGAAGTGGGAAAAGACTCTTGC       c.28440
 K  G  D  S  G  Q  Y  T  C  Y  A  V  N  E  V  G  K  D  S  C         p.9480

          .         .   | 100    .         .         .         .    g.125984
 ACAGCTCAGCTGAATATAAAAG | AGCGGCTCATCCCACCAAGTTTCACTAAAAGACTCTCA    c.28500
 T  A  Q  L  N  I  K  E |   R  L  I  P  P  S  F  T  K  R  L  S      p.9500

          .         .         .         .         .         .       g.126044
 GAGACAGTAGAAGAAACAGAAGGGAATTCTTTCAAACTTGAGGGACGTGTGGCTGGTTCC       c.28560
 E  T  V  E  E  T  E  G  N  S  F  K  L  E  G  R  V  A  G  S         p.9520

          .         .         .         .         .         .       g.126104
 CAACCTATAACTGTTGCCTGGTACAAAAATAATATAGAGATACAACCAACTTCTAACTGT       c.28620
 Q  P  I  T  V  A  W  Y  K  N  N  I  E  I  Q  P  T  S  N  C         p.9540

          .         .         .         .         .         .       g.126164
 GAAATAACATTCAAGAACAACACGTTAGTGCTGCAAGTCAGGAAAGCAGGCATGAACGAC       c.28680
 E  I  T  F  K  N  N  T  L  V  L  Q  V  R  K  A  G  M  N  D         p.9560

          .         .         .         .         .         .       g.126224
 GCTGGTTTGTACACATGCAAAGTGTCCAATGATGCAGGCTCTGCTCTGTGCACGTCTTCA       c.28740
 A  G  L  Y  T  C  K  V  S  N  D  A  G  S  A  L  C  T  S  S         p.9580

          .    | 101   .         .         .         .         .    g.128036
 ATCGTCATCAAAG | AACCTAAGAAGCCACCTGTATTTGATCAGCACCTTACTCCAGTAACA    c.28800
 I  V  I  K  E |   P  K  K  P  P  V  F  D  Q  H  L  T  P  V  T      p.9600

          .         .         .         .         .         .       g.128096
 GTGAGTGAAGGAGAATACGTGCAGCTCAGCTGCCATGTCCAGGGATCTGAGCCAATTAGG       c.28860
 V  S  E  G  E  Y  V  Q  L  S  C  H  V  Q  G  S  E  P  I  R         p.9620

          .         .         .         .         .         .       g.128156
 ATCCAGTGGTTGAAGGCTGGCAGGGAAATAAAGCCTTCAGACAGATGCAGCTTCAGCTTT       c.28920
 I  Q  W  L  K  A  G  R  E  I  K  P  S  D  R  C  S  F  S  F         p.9640

          .         .         .         .         .         .       g.128216
 GCTAGTGGGACAGCTGTACTGGAACTCAGAGATGTGGCTAAAGCAGATTCGGGAGATTAT       c.28980
 A  S  G  T  A  V  L  E  L  R  D  V  A  K  A  D  S  G  D  Y         p.9660

          .         .         .         .         .         .       g.128276
 GTGTGTAAAGCTTCAAATGTGGCTGGAAGTGACACTACCAAATCAAAAGTGACCATTAAA       c.29040
 V  C  K  A  S  N  V  A  G  S  D  T  T  K  S  K  V  T  I  K         p.9680

   | 102     .         .         .         .         .         .    g.128907
 G | ACAAACCAGCTGTGGCCCCAGCAACCAAGAAAGCTGCGGTAGATGGAAGACTCTTTTTT    c.29100
 D |   K  P  A  V  A  P  A  T  K  K  A  A  V  D  G  R  L  F  F      p.9700

          .         .         .     | 103  .         .         .    g.129089
 GTGTCAGAACCTCAGAGTATCAGAGTCGTAGAAA | AAACCACTGCGACCTTCATTGCAAAA    c.29160
 V  S  E  P  Q  S  I  R  V  V  E  K |   T  T  A  T  F  I  A  K      p.9720

          .         .         .         .         .         .       g.129149
 GTTGGAGGTGACCCAATCCCAAATGTTAAATGGACAAAAGGGAAGTGGAGACAGCTGAAC       c.29220
 V  G  G  D  P  I  P  N  V  K  W  T  K  G  K  W  R  Q  L  N         p.9740

          .         .         .         .         .         .       g.129209
 CAAGGAGGTCGTGTTTTCATCCACCAAAAAGGCGATGAAGCAAAACTGGAGATTAGGGAC       c.29280
 Q  G  G  R  V  F  I  H  Q  K  G  D  E  A  K  L  E  I  R  D         p.9760

          .         .         .         .         .         .       g.129269
 ACCACAAAAACTGATTCTGGGTTATACCGATGCGTGGCATTTAACGAACATGGTGAAATT       c.29340
 T  T  K  T  D  S  G  L  Y  R  C  V  A  F  N  E  H  G  E  I         p.9780

          .         .         .         .         .         .       g.129329
 GAAAGTAATGTTAACTTACAGGTGGATGAAAGGAAGAAACAAGAGAAAATTGAAGGCGAT       c.29400
 E  S  N  V  N  L  Q  V  D  E  R  K  K  Q  E  K  I  E  G  D         p.9800

          .         . | 104      .         .         .         .    g.130485
 CTTAGAGCAATGCTGAAAAA | GACTCCAATCTTAAAGAAAGGAGCTGGAGAAGAAGAGGAA    c.29460
 L  R  A  M  L  K  K  |  T  P  I  L  K  K  G  A  G  E  E  E  E      p.9820

          .         .         .         .         .         .       g.130545
 ATTGATATCATGGAACTTCTCAAAAATGTTGATCCTAAAGAATATGAAAAATATGCCCGC       c.29520
 I  D  I  M  E  L  L  K  N  V  D  P  K  E  Y  E  K  Y  A  R         p.9840

          .         .         .         .         .         .       g.130605
 ATGTATGGAATCACTGACTTCCGAGGTCTTCTTCAAGCATTTGAACTGCTCAAGCAAAGC       c.29580
 M  Y  G  I  T  D  F  R  G  L  L  Q  A  F  E  L  L  K  Q  S         p.9860

          .         .     | 105  .         .         .         .    g.130872
 CAAGAAGAAGAGACACATAGACTG | GAAATTGAGGAAATAGAGAGGTCAGAGAGGGACGAA    c.29640
 Q  E  E  E  T  H  R  L   | E  I  E  E  I  E  R  S  E  R  D  E      p.9880

          .         .         .         .         .     | 106  .    g.131031
 AAGGAATTTGAGGAACTTGTATCATTTATTCAGCAAAGACTGTCACAGACAGAG | CCTGTC    c.29700
 K  E  F  E  E  L  V  S  F  I  Q  Q  R  L  S  Q  T  E   | P  V      p.9900

          .         .         .         .         .         .       g.131091
 ACTCTGATCAAGGACATTGAAAATCAGACAGTTTTGAAAGATAATGATGCTGTCTTTGAA       c.29760
 T  L  I  K  D  I  E  N  Q  T  V  L  K  D  N  D  A  V  F  E         p.9920

          .         .         .         .         .         .       g.131151
 ATTGACATTAAAATTAATTATCCAGAAATCAAGCTTTCGTGGTACAAAGGAACTGAAAAA       c.29820
 I  D  I  K  I  N  Y  P  E  I  K  L  S  W  Y  K  G  T  E  K         p.9940

          .         .         .         .         .         .       g.131211
 CTGGAACCCAGTGATAAATTTGAAATAAGCATTGATGGTGACCGACATACACTCAGAGTC       c.29880
 L  E  P  S  D  K  F  E  I  S  I  D  G  D  R  H  T  L  R  V         p.9960

          .         .         .         .         .         .       g.131271
 AAAAACTGTCAACTTAAAGACCAGGGCAATTATCGATTGGTTTGTGGTCCACACATCGCT       c.29940
 K  N  C  Q  L  K  D  Q  G  N  Y  R  L  V  C  G  P  H  I  A         p.9980

          .         .   | 107    .         .         .         .    g.131433
 AGCGCTAAACTAACTGTAATTG | AGCCTGCATGGGAACGGCATCTTCAGGATGTGACTCTG    c.30000
 S  A  K  L  T  V  I  E |   P  A  W  E  R  H  L  Q  D  V  T  L      p.10000

          .         .         .         .         .         .       g.131493
 AAAGAAGGCCAGACTTGCACCATGACATGCCAATTTTCTGTACCAAATGTAAAATCTGAA       c.30060
 K  E  G  Q  T  C  T  M  T  C  Q  F  S  V  P  N  V  K  S  E         p.10020

          .         .         .         .         .         .       g.131553
 TGGTTCAGAAATGGCAGAATCCTTAAACCCCAAGGTAGACATAAAACAGAAGTGGAACAC       c.30120
 W  F  R  N  G  R  I  L  K  P  Q  G  R  H  K  T  E  V  E  H         p.10040

          .         .         .         .         .         .       g.131613
 AAAGTCCATAAATTGACCATTGCAGATGTTCGAGCAGAAGACCAGGGTCAGTACACCTGC       c.30180
 K  V  H  K  L  T  I  A  D  V  R  A  E  D  Q  G  Q  Y  T  C         p.10060

          .         .         .         .    | 108   .         .    g.133156
 AAATATGAAGACCTTGAAACTTCAGCAGAACTCAGAATCGAAG | CTGAACCAATTCAGTTT    c.30240
 K  Y  E  D  L  E  T  S  A  E  L  R  I  E  A |   E  P  I  Q  F      p.10080

          .         .         .         .         .         .       g.133216
 ACAAAGCGCATACAGAACATCGTGGTGAGTGAGCATCAGTCTGCCACCTTTGAGTGTGAA       c.30300
 T  K  R  I  Q  N  I  V  V  S  E  H  Q  S  A  T  F  E  C  E         p.10100

          .         .         .         .         .         .       g.133276
 GTGTCCTTTGATGATGCCATTGTAACATGGTACAAAGGACCAACAGAACTGACAGAGAGC       c.30360
 V  S  F  D  D  A  I  V  T  W  Y  K  G  P  T  E  L  T  E  S         p.10120

          .         .         .         .         .         .       g.133336
 CAGAAATACAACTTCAGGAATGATGGCCGCTGCCATTATATGACCATCCACAATGTGACC       c.30420
 Q  K  Y  N  F  R  N  D  G  R  C  H  Y  M  T  I  H  N  V  T         p.10140

          .    | 109   .         .         .         .         .    g.133604
 CCAGACGATGAAG | GTGTCTACTCGGTCATCGCTCGGCTGGAGCCAAGAGGTGAAGCAAGA    c.30480
 P  D  D  E  G |   V  Y  S  V  I  A  R  L  E  P  R  G  E  A  R      p.10160

          .         .         .  | 110     .         .         | 111 g.134217
 AGCACGGCAGAGCTGTACCTAACGACGAAAG | AAATCAAACTTGAGCTGAAGCCTCCTG | AT c.30540
 S  T  A  E  L  Y  L  T  T  K  E |   I  K  L  E  L  K  P  P  D |    p.10180

          .         .         .         .         .         | 112    g.134601
 ATTCCTGACTCCAGAGTTCCAATCCCAACCATGCCTATCAGAGCAGTGCCACCAGAAG | AA    c.30600
 I  P  D  S  R  V  P  I  P  T  M  P  I  R  A  V  P  P  E  E |       p.10200

          .         .         .         .         .         .       g.134661
 ATCCCTCCTGTGGTTGCTCCTCCTATCCCCCTTTTGCTACCAACACCCGAAGAAAAGAAA       c.30660
 I  P  P  V  V  A  P  P  I  P  L  L  L  P  T  P  E  E  K  K         p.10220

          .         .   | 113    .         .         .         .    g.136926
 CCACCACCAAAACGTATTGAAG | TTACCAAAAAGGCTGTGAAGAAAGATGCCAAAAAAGTT    c.30720
 P  P  P  K  R  I  E  V |   T  K  K  A  V  K  K  D  A  K  K  V      p.10240

          .         .         .     | 114  .         .         .    g.138660
 GTTGCAAAGCCCAAAGAGATGACACCACGTGAAG | AGATTGTCAAGAAGCCTCCACCTCCT    c.30780
 V  A  K  P  K  E  M  T  P  R  E  E |   I  V  K  K  P  P  P  P      p.10260

          .         .   | 115    .         .         .         .    g.139571
 ACTACCTTAATTCCAGCAAAAG | CTCCTGAAATCATTGATGTATCCTCTAAAGCTGAAGAA    c.30840
 T  T  L  I  P  A  K  A |   P  E  I  I  D  V  S  S  K  A  E  E      p.10280

          .         .         .         .         .         .       g.139631
 GTAAAAATAATGACTATAACCAGAAAGAAAGAGGTTCAGAAAGAAAAAGAAGCTGTGTAT       c.30900
 V  K  I  M  T  I  T  R  K  K  E  V  Q  K  E  K  E  A  V  Y         p.10300

          .         .         .         .         .         .       g.139691
 GAGAAAAAGCAAGCAGTCCACAAGGAGAAGAGAGTCTTCATTGAATCTTTCGAAGAACCT       c.30960
 E  K  K  Q  A  V  H  K  E  K  R  V  F  I  E  S  F  E  E  P         p.10320

          .         .         .         .         .         .       g.139751
 TATGACGAACTGGAGGTAGAACCATACACAGAGCCATTTGAACAACCTTATTATGAAGAA       c.31020
 Y  D  E  L  E  V  E  P  Y  T  E  P  F  E  Q  P  Y  Y  E  E         p.10340

          .         .         .         .         .         .       g.139811
 CCAGATGAAGACTATGAAGAGATTAAGGTAGAAGCTAAAAAAGAAGTTCACGAGGAATGG       c.31080
 P  D  E  D  Y  E  E  I  K  V  E  A  K  K  E  V  H  E  E  W         p.10360

          .         .         .         .         .         .       g.139871
 GAAGAAGATTTTGAAGAAGGGCAAGAATACTATGAAAGGGAAGAAGGCTATGACGAAGGG       c.31140
 E  E  D  F  E  E  G  Q  E  Y  Y  E  R  E  E  G  Y  D  E  G         p.10380

          .         .         .         .         .         .       g.139931
 GAGGAAGAGTGGGAAGAGGCTTACCAAGAAAGGGAAGTAATTCAAGTTCAAAAGGAGGTC       c.31200
 E  E  E  W  E  E  A  Y  Q  E  R  E  V  I  Q  V  Q  K  E  V         p.10400

         | 116         .         .         .         .         .    g.140445
 TATGAAG | AATCACATGAGAGAAAAGTTCCAGCCAAAGTACCTGAAAAGAAAGCACCACCA    c.31260
 Y  E  E |   S  H  E  R  K  V  P  A  K  V  P  E  K  K  A  P  P      p.10420

          . | 117      .         .         .         .         .    g.140946
 CCTCCTAAAG | TTATAAAGAAGCCAGTAATTGAAAAAATTGAAAAGACTTCTCGAAGAATG    c.31320
 P  P  K  V |   I  K  K  P  V  I  E  K  I  E  K  T  S  R  R  M      p.10440

          .         .         | 118        .         .         .    g.141158
 GAGGAAGAAAAAGTTCAAGTCACCAAAG | TACCTGAAGTTTCAAAGAAGATTGTTCCACAA    c.31380
 E  E  E  K  V  Q  V  T  K  V |   P  E  V  S  K  K  I  V  P  Q      p.10460

          .         .         .         .       | 119.         .    g.141808
 AAACCTTCCCGGACTCCAGTACAGGAAGAAGTTATTGAAGTGAAAG | TACCAGCTGTGCAT    c.31440
 K  P  S  R  T  P  V  Q  E  E  V  I  E  V  K  V |   P  A  V  H      p.10480

          .         .         .         .         .         .       g.141868
 ACAAAGAAGATGGTTATTTCAGAAGAAAAGATGTTCTTTGCTTCTCACACAGAGGAGGAG       c.31500
 T  K  K  M  V  I  S  E  E  K  M  F  F  A  S  H  T  E  E  E         p.10500

          .    | 120   .         .         .         .         .    g.142160
 GTGTCAGTCACAG | TCCCCGAGGTACAAAAGGAAATTGTTACTGAAGAGAAAATTCACGTT    c.31560
 V  S  V  T  V |   P  E  V  Q  K  E  I  V  T  E  E  K  I  H  V      p.10520

          .         .         .     | 121  .         .         .    g.143248
 GCCATTTCCAAAAGGGTTGAACCACCACCTAAAG | TCCCTGAGCTACCTGAGAAACCAGCT    c.31620
 A  I  S  K  R  V  E  P  P  P  K  V |   P  E  L  P  E  K  P  A      p.10540

          .         .         .         .         .         | 122    g.143705
 CCAGAAGAAGTGGCCCCTGTTCCTATCCCTAAAAAAGTGGAGCCCCCAGCACCAAAAG | TT    c.31680
 P  E  E  V  A  P  V  P  I  P  K  K  V  E  P  P  A  P  K  V |       p.10560

          .         .         .         .         .         .       g.143765
 CCTGAGGTTCCCAAGAAACCCGTGCCAGAGGAGAAAAAGCCAGTTCCTGTGCCTAAGAAG       c.31740
 P  E  V  P  K  K  P  V  P  E  E  K  K  P  V  P  V  P  K  K         p.10580

          .         .   | 123    .         .         .         .    g.145944
 GAACCTGCTGCTCCCCCAAAAG | TCCCAGAGGTGCCAAAGAAACCTGTCCCTGAAGAAAAG    c.31800
 E  P  A  A  P  P  K  V |   P  E  V  P  K  K  P  V  P  E  E  K      p.10600
                        ^ intron contains unconfirmed exon 123

          .         .         .         .       | 124.         .    g.146221
 ATTCCCGTTCCTGTTGCAAAGAAAAAGGAAGCTCCCCCAGCTAAAG | TTCCTGAAGTACAG    c.31860
 I  P  V  P  V  A  K  K  K  E  A  P  P  A  K  V |   P  E  V  Q      p.10620

          .         .         .         .         .         .       g.146281
 AAGGGAGTTGTGACAGAAGAAAAAATAACCATTGTAACTCAAAGAGAGGAATCTCCACCA       c.31920
 K  G  V  V  T  E  E  K  I  T  I  V  T  Q  R  E  E  S  P  P         p.10640

         | 125         .         .         .         .         .    g.146482
 CCAGCAG | TGCCAGAAATACCAAAGAAGAAAGTTCCTGAAGAAAGGAAACCTGTTCCTCGG    c.31980
 P  A  V |   P  E  I  P  K  K  K  V  P  E  E  R  K  P  V  P  R      p.10660

          .         .         .  | 126     .         .         .    g.146695
 AAGGAGGAAGAAGTTCCACCACCACCAAAAG | TGCCAGCTCTGCCTAAGAAACCCGTCCCA    c.32040
 K  E  E  E  V  P  P  P  P  K  V |   P  A  L  P  K  K  P  V  P      p.10680

          .         .         .         .         .      | 127 .    g.147029
 GAGGAGAAAGTTGCAGTGCCAGTTCCTGTCGCTAAGAAAGCTCCTCCTCCCCGAG | CTGAA    c.32100
 E  E  K  V  A  V  P  V  P  V  A  K  K  A  P  P  P  R  A |   E      p.10700

          .         .         .         .         .         .       g.147089
 GTCTCTAAGAAAACTGTTGTAGAAGAAAAGAGATTTGTTGCTGAAGAAAAACTATCCTTC       c.32160
 V  S  K  K  T  V  V  E  E  K  R  F  V  A  E  E  K  L  S  F         p.10720

          .         .         .        | 128         .         .    g.147601
 GCAGTTCCTCAAAGAGTGGAAGTCACGCGGCACGAAG | TATCTGCAGAGGAGGAATGGAGT    c.32220
 A  V  P  Q  R  V  E  V  T  R  H  E  V |   S  A  E  E  E  W  S      p.10740

          .         .         .         .         .         .       g.147661
 TACTCAGAAGAGGAGGAAGGTGTGTCCATTTCAGTTTATAGAGAAGAAGAAAGAGAGGAG       c.32280
 Y  S  E  E  E  E  G  V  S  I  S  V  Y  R  E  E  E  R  E  E         p.10760

          .         .         .  | 129     .         .         .    g.150233
 GAGGAAGAAGCAGAGGTTACAGAATATGAAG | TGATGGAAGAGCCTGAGGAATATGTTGTG    c.32340
 E  E  E  A  E  V  T  E  Y  E  V |   M  E  E  P  E  E  Y  V  V      p.10780

          .         .         .         .         .   | 130    .    g.150480
 GAAGAAAAGCTGCACATTATTTCTAAGAGAGTGGAAGCTGAGCCAGCTGAAG | TGACAGAG    c.32400
 E  E  K  L  H  I  I  S  K  R  V  E  A  E  P  A  E  V |   T  E      p.10800

          .         .         .         .         .         .       g.150540
 AGGCAGGAGAAGAAAATTGTACTGAAACCAAAAATTCCTGCTAAAATAGAGGAGCCTCCA       c.32460
 R  Q  E  K  K  I  V  L  K  P  K  I  P  A  K  I  E  E  P  P         p.10820

          . | 131      .         .         .         .         .    g.150863
 CCGGCTAAAG | TTCCTGAAGCACCTAAGAAAATTGTGCCAGAAAAGAAAGTTCCTGCTCCA    c.32520
 P  A  K  V |   P  E  A  P  K  K  I  V  P  E  K  K  V  P  A  P      p.10840

          .         .         .     | 132  .         .         .    g.151079
 GTTCCTAAAAAGGAAAAGGTGCCCCCACCTAAAG | TGCCAGAAGAGCCAAAGAAACCAGTT    c.32580
 V  P  K  K  E  K  V  P  P  P  K  V |   P  E  E  P  K  K  P  V      p.10860

          .         .         .         .         .         | 133    g.151391
 CCAGAAAAAAAGGTTCCTCCAAAAGTCATTAAGATGGAAGAACCTCTCCCAGCCAAAG | TG    c.32640
 P  E  K  K  V  P  P  K  V  I  K  M  E  E  P  L  P  A  K  V |       p.10880

          .         .         .         .         .         .       g.151451
 ACTGAGAGGCACATGCAAATTACCCAGGAAGAAAAAGTTCTTGTTGCTGTAACTAAAAAA       c.32700
 T  E  R  H  M  Q  I  T  Q  E  E  K  V  L  V  A  V  T  K  K         p.10900

          .         .   | 134    .         .         .         .    g.151758
 GAGGCGCCTCCAAAAGCAAGAG | TGCCAGAGGAACCGAAGAGAGCTGTCCCAGAAGAAAAA    c.32760
 E  A  P  P  K  A  R  V |   P  E  E  P  K  R  A  V  P  E  E  K      p.10920

          .         .         .         .       | 135.         .    g.152525
 GTTCTGAAACTCAAACCTAAAAGAGAGGAGGAACCACCAGCTAAAG | TGACTGAATTCAGA    c.32820
 V  L  K  L  K  P  K  R  E  E  E  P  P  A  K  V |   T  E  F  R      p.10940

          .         .         .         .         .         .       g.152585
 AAAAGAGTGGTTAAAGAAGAAAAAGTATCAATTGAAGCTCCAAAAAGAGAACCTCAACCC       c.32880
 K  R  V  V  K  E  E  K  V  S  I  E  A  P  K  R  E  P  Q  P         p.10960

         | 136         .         .         .         .         .    g.152952
 ATCAAAG | AAGTAACTATAATGGAAGAGAAAGAAAGGGCTTATACCCTAGAAGAAGAAGCT    c.32940
 I  K  E |   V  T  I  M  E  E  K  E  R  A  Y  T  L  E  E  E  A      p.10980

          .         .         .         .         .         .       g.153012
 GTTTCAGTACAACGGGAAGAAGAATATGAGGAATATGAAGAATATGATTATAAAGAATTT       c.33000
 V  S  V  Q  R  E  E  E  Y  E  E  Y  E  E  Y  D  Y  K  E  F         p.11000

          .         .         .         .         .         .       g.153072
 GAGGAGTATGAACCAACAGAAGAATATGACCAATATGAAGAATACGAGGAGCGGGAGTAT       c.33060
 E  E  Y  E  P  T  E  E  Y  D  Q  Y  E  E  Y  E  E  R  E  Y         p.11020

          .         .         .     | 137  .         .         .    g.154090
 GAACGATATGAAGAGCATGAAGAATACATCACAG | AACCAGAGAAGCCTATCCCTGTAAAG    c.33120
 E  R  Y  E  E  H  E  E  Y  I  T  E |   P  E  K  P  I  P  V  K      p.11040

          .         .         .         .         .   | 138    .    g.154360
 CCTGTCCCAGAAGAACCAGTTCCCACAAAACCAAAGGCCCCACCGGCTAAAG | TGCTGAAG    c.33180
 P  V  P  E  E  P  V  P  T  K  P  K  A  P  P  A  K  V |   L  K      p.11060

          .         .         .         .         .         .       g.154420
 AAAGCTGTCCCTGAAGAAAAAGTACCAGTGCCCATTCCTAAGAAACTCAAACCTCCACCA       c.33240
 K  A  V  P  E  E  K  V  P  V  P  I  P  K  K  L  K  P  P  P         p.11080

         | 139         .         .         .         .         .    g.154684
 CCCAAAG | TGCCTGAAGAACCAAAGAAAGTTTTTGAGGAAAAAATACGTATTTCAATTACC    c.33300
 P  K  V |   P  E  E  P  K  K  V  F  E  E  K  I  R  I  S  I  T      p.11100

          .         .         .         . | 140      .         .    g.155491
 AAACGTGAAAAAGAGCAGGTGACTGAACCCGCTGCTAAAG | TGCCCATGAAGCCCAAGAGG    c.33360
 K  R  E  K  E  Q  V  T  E  P  A  A  K  V |   P  M  K  P  K  R      p.11120

          .         .         .         .         .         | 141    g.155749
 GTTGTCGCAGAAGAAAAAGTACCTGTCCCTAGAAAAGAAGTAGCACCACCTGTTAGAG | TG    c.33420
 V  V  A  E  E  K  V  P  V  P  R  K  E  V  A  P  P  V  R  V |       p.11140

          .         .         .         .         .         .       g.155809
 CCAGAAGTGCCTAAAGAACTTGAACCAGAAGAGGTTGCCTTTGAAGAGGAAGTTGTAACC       c.33480
 P  E  V  P  K  E  L  E  P  E  E  V  A  F  E  E  E  V  V  T         p.11160

          .         .         .         .         .         .       g.155869
 CATGTAGAAGAATATCTTGTAGAAGAAGAAGAAGAGTACATTCATGAAGAAGAGGAGTTC       c.33540
 H  V  E  E  Y  L  V  E  E  E  E  E  Y  I  H  E  E  E  E  F         p.11180

          .         .         .         . | 142      .         .    g.156140
 ATAACTGAGGAAGAAGTGGTGCCAGTGATACCAGTCAAAG | TGCCTGAGGTACCCAGGAAA    c.33600
 I  T  E  E  E  V  V  P  V  I  P  V  K  V |   P  E  V  P  R  K      p.11200

          .         .         .         .         .         .       g.156200
 CCTGTTCCAGAAGAGAAGAAACCTGTTCCTGTTCCCAAGAAGAAGGAAGCTCCACCGGCA       c.33660
 P  V  P  E  E  K  K  P  V  P  V  P  K  K  K  E  A  P  P  A         p.11220

      | 143  .         .         .         .         .         .    g.156442
 AAAG | TGCCTGAGGTTCCTAAGAAGCCAGAGGAGAAAGTTCCTGTGCTTATTCCTAAAAAG    c.33720
 K  V |   P  E  V  P  K  K  P  E  E  K  V  P  V  L  I  P  K  K      p.11240

          .         .   | 144    .         .         .         .    g.157010
 GAGAAGCCTCCGCCAGCAAAAG | TTCCTGAAGTGCCCAAGAAACCTGTGCCAGAGGAGAAA    c.33780
 E  K  P  P  P  A  K  V |   P  E  V  P  K  K  P  V  P  E  E  K      p.11260

          .         .         .         .       | 145.         .    g.157319
 GTACCAGTACCAGTTCCTAAAAAGGTGGAAGCTCCACCTGCCAAAG | TGCCAGAGGTACCC    c.33840
 V  P  V  P  V  P  K  K  V  E  A  P  P  A  K  V |   P  E  V  P      p.11280

          .         .         .         .         .         .       g.157379
 AAGAAGCCTGTGCCTGAGAAGAAGGTGCCAGTTCCTGCTCCTAAGAAAGTGGAGGCTCCA       c.33900
 K  K  P  V  P  E  K  K  V  P  V  P  A  P  K  K  V  E  A  P         p.11300

          . | 146      .         .         .         .         .    g.157644
 CCTGCAAAAG | TGCCAGAGGTGCCCAAGAAGCTCATCCCAGAAGAAAAGAAACCAACACCT    c.33960
 P  A  K  V |   P  E  V  P  K  K  L  I  P  E  E  K  K  P  T  P      p.11320

          .         .         .     | 147  .         .         .    g.157911
 GTTCCGAAAAAAGTGGAAGCACCACCACCCAAAG | TGCCAAAGAAACGTGAACCAGTTCCA    c.34020
 V  P  K  K  V  E  A  P  P  P  K  V |   P  K  K  R  E  P  V  P      p.11340

          .         .         .         .         .         .       g.157971
 GTTCCTGTAGCTCTACCTCAGGAAGAGGAAGTTCTATTTGAAGAAGAAATTGTTCCTGAA       c.34080
 V  P  V  A  L  P  Q  E  E  E  V  L  F  E  E  E  I  V  P  E         p.11360

          .         .         .         .         .         .       g.158031
 GAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGAA       c.34140
 E  E  V  L  P  E  E  E  E  V  L  P  E  E  E  E  V  L  P  E         p.11380

          .         .         .         .         .         .       g.158091
 GAAGAGGAAGTTCTACCTGAAGAAGAGGAAATTCCACCTGAGGAAGAGGAAGTTCCTCCC       c.34200
 E  E  E  V  L  P  E  E  E  E  I  P  P  E  E  E  E  V  P  P         p.11400

          .         .         .         .         .         .       g.158151
 GAAGAAGAATATGTACCTGAGGAAGAAGAATTTGTACCTGAAGAAGAAGTCCTTCCAGAA       c.34260
 E  E  E  Y  V  P  E  E  E  E  F  V  P  E  E  E  V  L  P  E         p.11420

          .         .         .  | 148     .         .         .    g.158544
 GTTAAACCTAAGGTGCCAGTACCTGCACCAG | TGCCTGAAGTGCCAAAGAAACCTGTACCA    c.34320
 V  K  P  K  V  P  V  P  A  P  V |   P  E  V  P  K  K  P  V  P      p.11440

          .         .         .         .         .         | 149    g.159809
 GAGAAGAAAGTCCCTGTTCCCGCCCCTAAAAAAGTGGAACCTCCACCACCACCCAAAG | TG    c.34380
 E  K  K  V  P  V  P  A  P  K  K  V  E  P  P  P  P  P  K  V |       p.11460

          .         .         .         .         .         .       g.159869
 CCTGAAATTAAGAAGAAAGTGACAGAGAAGAAAGTGGTCATTCCCAAGAAAGAGGAGGCT       c.34440
 P  E  I  K  K  K  V  T  E  K  K  V  V  I  P  K  K  E  E  A         p.11480

          .    | 150   .         .         .         .         .    g.160095
 CCCCCTGCCAAAG | TGTCTGTGGTACCTAAGAAACCTGAGCCAGAAAAGAAGGTCCCTCCT    c.34500
 P  P  A  K  V |   S  V  V  P  K  K  P  E  P  E  K  K  V  P  P      p.11500

          .         .         .        | 151         .         .    g.160712
 CCTGGTCTTAAGAAAGCAGTGGCCCCTCCTGCCAAAG | TTCCTGAGGTGCCTAAGAAGGTG    c.34560
 P  G  L  K  K  A  V  A  P  P  A  K  V |   P  E  V  P  K  K  V      p.11520

          .         .         .         .         .   | 152    .    g.161401
 GAAGAAAAACGAATCATTCTCCCTAAAGAAGAGGAAGTTCTACCAGTTGAAG | TGACTGAG    c.34620
 E  E  K  R  I  I  L  P  K  E  E  E  V  L  P  V  E  V |   T  E      p.11540

          .         .         .         .         .         .       g.161461
 GAGCCTGAAGAAGAGCCTATTTCAGAAGAAGAAATCCCAGAAGAACCACCTAGCATAGAG       c.34680
 E  P  E  E  E  P  I  S  E  E  E  I  P  E  E  P  P  S  I  E         p.11560

          .         .         | 153        .         .         .    g.162124
 GAAGTTGAAGAGGTGGCACCACCTAGAG | TGCCTGAAGTGATTAAGAAAGCAGTACCTGAA    c.34740
 E  V  E  E  V  A  P  P  R  V |   P  E  V  I  K  K  A  V  P  E      p.11580

          .         .         .         .       | 154.         .    g.163113
 GCACCTACTCCTGTTCCTAAAAAAGTGGAGGCACCACCAGCTAAAG | TGTCAAAGAAAATT    c.34800
 A  P  T  P  V  P  K  K  V  E  A  P  P  A  K  V |   S  K  K  I      p.11600

          .         .         .         .         .      | 155 .    g.163326
 CCTGAGGAAAAAGTACCTGTTCCTGTTCAGAAAAAAGAGGCACCCCCAGCCAAAG | TGCCT    c.34860
 P  E  E  K  V  P  V  P  V  Q  K  K  E  A  P  P  A  K  V |   P      p.11620

          .         .         .         .         .         .       g.163386
 GAAGTACCAAAGAAAGTCCCAGAAAAGAAAGTCCTTGTGCCTAAAAAGGAAGCTGTTCCC       c.34920
 E  V  P  K  K  V  P  E  K  K  V  L  V  P  K  K  E  A  V  P         p.11640

          . | 156      .         .         .         .         .    g.163585
 CCAGCTAAAG | GGAGAACTGTCCTTGAAGAAAAAGTATCAGTTGCCTTCCGCCAAGAAGTA    c.34980
 P  A  K  G |   R  T  V  L  E  E  K  V  S  V  A  F  R  Q  E  V      p.11660

          .         .         .         .         .         .       g.163645
 GTAGTAAAAGAAAGACTAGAATTAGAAGTAGTAGAAGCAGAAGTGGAAGAAATTCCGGAA       c.35040
 V  V  K  E  R  L  E  L  E  V  V  E  A  E  V  E  E  I  P  E         p.11680

          .         .         .         .         .         .       g.163705
 GAAGAAGAGTTCCATGAAGTTGAAGAATATTTTGAAGAAGGCGAGTTTCATGAAGTAGAA       c.35100
 E  E  E  F  H  E  V  E  E  Y  F  E  E  G  E  F  H  E  V  E         p.11700

          .         .         .         .         .         .       g.163765
 GAATTCATCAAATTAGAACAACATAGAGTTGAAGAAGAACACAGAGTTGAAAAAGTTCAT       c.35160
 E  F  I  K  L  E  Q  H  R  V  E  E  E  H  R  V  E  K  V  H         p.11720

          .         .         .         .         .         .       g.163825
 AGGGTAATAGAAGTTTTTGAGGCTGAAGAAGTGGAAGTATTTGAAAAACCAAAAGCTCCA       c.35220
 R  V  I  E  V  F  E  A  E  E  V  E  V  F  E  K  P  K  A  P         p.11740

         | 157         .         .         .         .         .    g.164685
 CCTAAAG | GGCCTGAGATATCTGAGAAAATCATCCCTCCAAAAAAACCGCCCACTAAAGTT    c.35280
 P  K  G |   P  E  I  S  E  K  I  I  P  P  K  K  P  P  T  K  V      p.11760

          .         .         | 158        .         .         .    g.165539
 GTTCCTCGAAAAGAGCCACCAGCTAAAG | TACCGGAGGTGCCTAAGAAAATTGTGGTAGAA    c.35340
 V  P  R  K  E  P  P  A  K  V |   P  E  V  P  K  K  I  V  V  E      p.11780

          .         .         .         .       | 159.         .    g.166141
 GAAAAAGTACGTGTTCCTGAAGAGCCCAGAGTTCCACCAACTAAAG | CACCCGAAGTACCC    c.35400
 E  K  V  R  V  P  E  E  P  R  V  P  P  T  K  A |   P  E  V  P      p.11800

          .         .         .         .         .         .       g.166201
 AAGAAAATTGTCCCAGAAGAAAAAGTTCGTGAAGCTGTTCTGAAAAAGCCTGAAGTTCCA       c.35460
 K  K  I  V  P  E  E  K  V  R  E  A  V  L  K  K  P  E  V  P         p.11820

          . | 160      .         .         .         .         .    g.166405
 CCAGCTAAAG | TTCCTGGGATGCCTAAGAAAAGTGTTCAAGAAGAAAAATCACCTATTGTT    c.35520
 P  A  K  V |   P  G  M  P  K  K  S  V  Q  E  E  K  S  P  I  V      p.11840

          .         .      | 161 .         .         .         .    g.168116
 ATTTCTGAAGACACAGAGATGTACA | TTTATGAAGCATCTGAAGAAGCAGTCCTAGAAGAA    c.35580
 I  S  E  D  T  E  M  Y  I |   Y  E  A  S  E  E  A  V  L  E  E      p.11860

          .         .         .         .          | 162       .    g.168288
 AAAGTACTTGTGACTCAACCTCAAAAGACAAAACCCAAACTAGCAAAAG | TGCCTGAGCCA    c.35640
 K  V  L  V  T  Q  P  Q  K  T  K  P  K  L  A  K  V |   P  E  P      p.11880

          .         .         .         .         .         .       g.168348
 CCCAAGAAAGTTGTTCCAGAAGACAAAATATATGTGACTATTCCTAAAAAGAGAGAAACA       c.35700
 P  K  K  V  V  P  E  D  K  I  Y  V  T  I  P  K  K  R  E  T         p.11900

          .    | 163   .         .         .         .         .    g.168530
 CCAGCAACTAAAG | AACCTGATACAACCAGAGGCATTTTTCCAGAGGTGGAGCCACCTGAG    c.35760
 P  A  T  K  E |   P  D  T  T  R  G  I  F  P  E  V  E  P  P  E      p.11920

          .         .         .        | 164         .         .    g.168924
 GCTATTCCTGAAATTCCAGAACATCCTCCAACTGAAG | AGTTTGAAGTCTTCAAGGAAGTC    c.35820
 A  I  P  E  I  P  E  H  P  P  T  E  E |   F  E  V  F  K  E  V      p.11940

          .         .         .         .         .      | 165 .    g.170016
 ATTCCAGAGGGAGAAACTCCTATTGTTAAAAGAAGAAAAACACCATCACCAACAG | TGCCT    c.35880
 I  P  E  G  E  T  P  I  V  K  R  R  K  T  P  S  P  T  V |   P      p.11960

          .         .         .         .         .         .       g.170076
 GAATCACCTCGAGAAATTGTCCCTGTAAAGGAAACACCCATGGCTGCTCCCCTTGAAATT       c.35940
 E  S  P  R  E  I  V  P  V  K  E  T  P  M  A  A  P  L  E  I         p.11980

          .          | 166       .         .         .         .    g.170383
 GAAATACCTCCCACTAAAG | CACCAGAAGCTATGAAAGAAGTTGTCCCTGAAATGAAAATA    c.36000
 E  I  P  P  T  K  A |   P  E  A  M  K  E  V  V  P  E  M  K  I      p.12000

          .         .         .         .    | 167   .         .    g.170893
 TTTGAGGATGTACCTGAAGAGCCAGAAACTCCACGTATGAAAA | CGCCCGAAGCTCCTCAA    c.36060
 F  E  D  V  P  E  E  P  E  T  P  R  M  K  T |   P  E  A  P  Q      p.12020

          .         .         .         .         .         | 168    g.171067
 GAAATTATTCCTGCCAAGACAGTTCCTTCCAAAAAAAGAGAACCCCCATCAGTTAAAG | TG    c.36120
 E  I  I  P  A  K  T  V  P  S  K  K  R  E  P  P  S  V  K  V |       p.12040

          .         .         .         .         .         .       g.171127
 CCTGAAGCTCTCCAAGAAATTGTCCCTGAAAAGAAAACGCTTGTGGTTCCTCTCAGAAAG       c.36180
 P  E  A  L  Q  E  I  V  P  E  K  K  T  L  V  V  P  L  R  K         p.12060

          .         .   | 169    .         .         .         .    g.171303
 CCTGAAGTCCTTCCTGATGAAG | TGCCGGAGGCTCTCAGAGAAGTTGTCCCGGAAAAGAAA    c.36240
 P  E  V  L  P  D  E  V |   P  E  A  L  R  E  V  V  P  E  K  K      p.12080

          .         .         .         . | 170      .         .    g.171724
 GTGCATCCTCCCCAAAGGGCTGAAGTTGTACCTGTCAAAG | TGCACGAAGCTCCCAAAGAG    c.36300
 V  H  P  P  Q  R  A  E  V  V  P  V  K  V |   H  E  A  P  K  E      p.12100

          .         .         .         .         .         .       g.171784
 ATTATCCCTGAAAAGAAAGTGTCGGTGGTGCCTCCTAAAAAGCCTGAAGTCCCACCTGTT       c.36360
 I  I  P  E  K  K  V  S  V  V  P  P  K  K  P  E  V  P  P  V         p.12120

      | 171  .         .         .         .         .         .    g.171956
 AAAG | TGCCAGAAGCTTCCAAAGAGGTTATCCGCGAAGAGAAAGTGCCCTTGGCTCCTCCT    c.36420
 K  V |   P  E  A  S  K  E  V  I  R  E  E  K  V  P  L  A  P  P      p.12140

          .         .         | 172        .         .         .    g.172124
 AAAGAGCCTGAAGTCCCACCTGTTAAAG | TACCAGAGCCTCCCAAAGAAGTAGTTCCTGAA    c.36480
 K  E  P  E  V  P  P  V  K  V |   P  E  P  P  K  E  V  V  P  E      p.12160

          .         .         .         .         .   | 173    .    g.172294
 AAGAAAGCGCCAGTGGCTCCTCCTAAAGAGCCTGAAGTCCCACCTGTTAAAG | TGCCTGAG    c.36540
 K  K  A  P  V  A  P  P  K  E  P  E  V  P  P  V  K  V |   P  E      p.12180

          .         .         .         .         .         .       g.172354
 GCTCCCAAAGAAGTTGTTCCTGAAAAGAAAGTGCCAGTGCCTCCTCCTAAAAAGCCTGAA       c.36600
 A  P  K  E  V  V  P  E  K  K  V  P  V  P  P  P  K  K  P  E         p.12200

          .       | 174.         .         .         .         .    g.172497
 GTGCCACCCACAAAAG | TCCCAGAGGTGCCAAAGGCAGCTGTCCCAGAAAAGAAGTTGCCT    c.36660
 V  P  P  T  K  V |   P  E  V  P  K  A  A  V  P  E  K  K  L  P      p.12220

          .         .         .         . | 175      .         .    g.172767
 GAAGCTATTCCTCCCAAACCGGAAAGTCCTCCCCCTGAAG | TGCCTGAAGTGCTGCCACCG    c.36720
 E  A  I  P  P  K  P  E  S  P  P  P  E  V |   P  E  V  L  P  P      p.12240

          .         .         .         .         .         .       g.172827
 AAGGAAGTGGTCCCAGAAAAGAAAGTACCGGTGCCTCCTGCCAAAAAGCCAGAAGCTCCA       c.36780
 K  E  V  V  P  E  K  K  V  P  V  P  P  A  K  K  P  E  A  P         p.12260

          . | 176      .         .         .         .         .    g.173040
 CCTCCTAAAG | TTCCTGAAGCTCCTAAAGAAGTTGTACTTGAAAAGAAAGCATCTGTGGCT    c.36840
 P  P  K  V |   P  E  A  P  K  E  V  V  L  E  K  K  A  S  V  A      p.12280

          .         .         .     | 177  .         .         .    g.173212
 GTGCCCAAAAAACCGGAAGCCCCACGTGCAAAAG | TGCCTGAAGCTGCTCAAGAAGTTGTC    c.36900
 V  P  K  K  P  E  A  P  R  A  K  V |   P  E  A  A  Q  E  V  V      p.12300

          .         .         .         .         .         | 178    g.173386
 CCAGAAAAGAAAATTCCCAAGGCACCAATCAAAAAACCAGAAGCCCCCGCAGTTACAG | TG    c.36960
 P  E  K  K  I  P  K  A  P  I  K  K  P  E  A  P  A  V  T  V |       p.12320

          .         .         .         .         .         .       g.173446
 CCAGAAGTTCCTCAAGAAGCCACAGAAAAAGAAATTCCCGTGGCTCCACCCAAAAAACCA       c.37020
 P  E  V  P  Q  E  A  T  E  K  E  I  P  V  A  P  P  K  K  P         p.12340

          .          | 179       .         .         .         .    g.173621
 GAAGCTCCAATTGTCCCAG | TGCCTGAAGCTCAAGAAGTTGTCCCAGAAAAGAAAGTTCCT    c.37080
 E  A  P  I  V  P  V |   P  E  A  Q  E  V  V  P  E  K  K  V  P      p.12360

          .         .         .         . | 180      .         .    g.173794
 AAGGCTCCTCCCACAAAACCAGAAGCCCCACCTGCCACAG | TGCCTGAAGTCCCACAAGAA    c.37140
 K  A  P  P  T  K  P  E  A  P  P  A  T  V |   P  E  V  P  Q  E      p.12380

          .         .         .         .         .         .       g.173854
 ATTGTGCCAGAAAAGAAAACACTGGTGCTTCCTAAAAAGCCAGAAGTTCCACCTGTTACA       c.37200
 I  V  P  E  K  K  T  L  V  L  P  K  K  P  E  V  P  P  V  T         p.12400

   | 181     .         .         .         .         .         .    g.174019
 G | TGCCAGAGGCTCCCAAAGAAGTTGTCCTTGAAAAGAAAGTGCCCTCGGCTCCTCCTAAA    c.37260
 V |   P  E  A  P  K  E  V  V  L  E  K  K  V  P  S  A  P  P  K      p.12420

          .         .      | 182 .         .         .         .    g.176582
 AAGCCTGAAGTCCCACCTGTTAAAG | TGCCTGAGGCTCCCAAAGAAGTTGTTCCTGAAAAG    c.37320
 K  P  E  V  P  P  V  K  V |   P  E  A  P  K  E  V  V  P  E  K      p.12440

          .         .         .         .          | 183       .    g.176725
 AAAGTGCCAGTGCCTCCTCCTAAAAAGCCTGAAGTGCCACCCACAAAAG | TCCCAGAGGTG    c.37380
 K  V  P  V  P  P  P  K  K  P  E  V  P  P  T  K  V |   P  E  V      p.12460

          .         .         .         .         .         .       g.176785
 CCAAAGGCAGCTGTCCCAGAAAAGAAGGTGCCTGAAGCTATTCCTCCCAAACCGGAAAGT       c.37440
 P  K  A  A  V  P  E  K  K  V  P  E  A  I  P  P  K  P  E  S         p.12480

          .    | 184   .         .         .         .         .    g.177055
 CCTCCCCCTGAAG | TGCCTGAAGTGCTGCCACCGAAGGAAGTGGTCCCAGAAAAGAAAGTA    c.37500
 P  P  P  E  V |   P  E  V  L  P  P  K  E  V  V  P  E  K  K  V      p.12500

          .         .         .         .    | 185   .         .    g.177268
 CCGGTGCCTCCTGCCAAAAAGCCAGAAGCTCCACCTCCTAAAG | TTCCTGAAGCTCCTAAA    c.37560
 P  V  P  P  A  K  K  P  E  A  P  P  P  K  V |   P  E  A  P  K      p.12520

          .         .         .         .         .         .       g.177328
 GAAGTTGTACTTGAAAAGAAAGCATCTGTGGCTGTGCCCAAAAAACCGGAAGCCCCACGT       c.37620
 E  V  V  L  E  K  K  A  S  V  A  V  P  K  K  P  E  A  P  R         p.12540

         | 186         .         .         .         .         .    g.177500
 GCAAAAG | TGCCTGAAGCTGCTCAAGAAGTTGTCCCAGAAAAGAAAATTCCCAAGGCACCA    c.37680
 A  K  V |   P  E  A  A  Q  E  V  V  P  E  K  K  I  P  K  A  P      p.12560

          .         .         .  | 187     .         .         .    g.177674
 ATCAAAAAACCAGAAGCCCCCGCAGTTACAG | TGCCAGAAGTTCCTCAAGAAGCCGCAGAA    c.37740
 I  K  K  P  E  A  P  A  V  T  V |   P  E  V  P  Q  E  A  A  E      p.12580

          .         .         .         .         .   | 188    .    g.177849
 AAAGAAATTCCCGTGGCTCCACCCAAAAAACCAGAAGCTCCGATTGTCCCAG | TGCCTGAA    c.37800
 K  E  I  P  V  A  P  P  K  K  P  E  A  P  I  V  P  V |   P  E      p.12600

          .         .         .         .         .         .       g.177909
 GCTCAAGAAGTTGTCCCAGAAAAGAAAGTTCCTAAGGCTCCTCCCACAAAACCAGAAGCC       c.37860
 A  Q  E  V  V  P  E  K  K  V  P  K  A  P  P  T  K  P  E  A         p.12620

          .    | 189   .         .         .         .         .    g.178082
 CCACCTGCCACAG | TGCCTGAAGTCCCACAAGAAATTGTGCCAGAAAAGAAAACACTGGTG    c.37920
 P  P  A  T  V |   P  E  V  P  Q  E  I  V  P  E  K  K  T  L  V      p.12640

          .         .         .     | 190  .         .         .    g.178247
 CTTCCTAAAAAGCCAGAAGTTCCACCTGTTACAG | TGCCAGAGGCTCCCAAAGAAGTTGTC    c.37980
 L  P  K  K  P  E  V  P  P  V  T  V |   P  E  A  P  K  E  V  V      p.12660

          .         .         .         .         .         | 191    g.180809
 CTTGAAAAGAAAGTGCCCTCGACTCCTCCTAAAAAGCCTGAAGTCCCACCTGTTAAAG | TG    c.38040
 L  E  K  K  V  P  S  T  P  P  K  K  P  E  V  P  P  V  K  V |       p.12680

          .         .         .         .         .         .       g.180869
 CCTGAGGCTCCCAAAGAAGTTGTTCCTGAAAAGAAAGTGCCAGTGCCTCCTCCTAAAAAG       c.38100
 P  E  A  P  K  E  V  V  P  E  K  K  V  P  V  P  P  P  K  K         p.12700

          .         .   | 192    .         .         .         .    g.181012
 CCTGAAGTGCCACCCACAAAAG | TCCCAGAGGTGCCAAAGGCAGCTGTCCCAGAAAAGAAG    c.38160
 P  E  V  P  P  T  K  V |   P  E  V  P  K  A  A  V  P  E  K  K      p.12720

          .         .         .         .       | 193.         .    g.181282
 GTGCCTGAAGCTATTCCTCCCAAACCGGAAAGTCCTCCCCCTGAAG | TGCCTGAAGTGCTG    c.38220
 V  P  E  A  I  P  P  K  P  E  S  P  P  P  E  V |   P  E  V  L      p.12740

          .         .         .         .         .         .       g.181342
 CCACCGAAGGAAGTGGTCCCAGAAAAGAAAGTACCGGTGCCTCCTGCCAAAAAGCCAGAA       c.38280
 P  P  K  E  V  V  P  E  K  K  V  P  V  P  P  A  K  K  P  E         p.12760

          .       | 194.         .         .         .         .    g.181555
 GCTCCACCTCCTAAAG | TTCCTGAAGCTCCTAAAGAAGTTGTACTTGAAAAGAAAGTATCT    c.38340
 A  P  P  P  K  V |   P  E  A  P  K  E  V  V  L  E  K  K  V  S      p.12780

          .         .         .         . | 195      .         .    g.181727
 GTGGCTGTGCCCAAAAAACCGGAAGCCCCACGTGCAAAAG | TGCCTGAAGCTGCTCAAGAA    c.38400
 V  A  V  P  K  K  P  E  A  P  R  A  K  V |   P  E  A  A  Q  E      p.12800

          .         .         .         .         .         .       g.181787
 GTTGTCCCAGAAAAGAAAATTCCCAAGGCACCAATCAAAAAACCAGAAGCCCCCGCAGTT       c.38460
 V  V  P  E  K  K  I  P  K  A  P  I  K  K  P  E  A  P  A  V         p.12820

      | 196  .         .         .         .         .         .    g.181961
 ACAG | TGCCAGAAGTTCCTCAAGAAGCCGCAGAAAAAGAAATTCCCGTGGCTCCACCCAAA    c.38520
 T  V |   P  E  V  P  Q  E  A  A  E  K  E  I  P  V  A  P  P  K      p.12840

          .         .      | 197 .         .         .         .    g.182136
 AAACCAGAAGCTCCAATTGTCCCAG | TGCCTGAAGCTCAAGAAGTTGTCCCAGAAAAGAAA    c.38580
 K  P  E  A  P  I  V  P  V |   P  E  A  Q  E  V  V  P  E  K  K      p.12860

          .         .         .         .       | 198.         .    g.182309
 GTTCCTAAGGCTCCTCCCACAAAACCAGAAGCCCCACCTGCCACAG | TGCCTGAAGTCCCA    c.38640
 V  P  K  A  P  P  T  K  P  E  A  P  P  A  T  V |   P  E  V  P      p.12880

          .         .         .         .         .         .       g.182369
 CAAGAAATTGTGCCAGAAAAGAAAACACTGGTGCTTCCTAAAAAGCCAGAAGTTCCACCT       c.38700
 Q  E  I  V  P  E  K  K  T  L  V  L  P  K  K  P  E  V  P  P         p.12900

         | 199         .         .         .         .         .    g.182534
 GTTACAG | TGCCAGAGGCTCCCAAAGAAGTTGTCCTTGAAAAGAAAGTGCCCTTGGCTCCT    c.38760
 V  T  V |   P  E  A  P  K  E  V  V  L  E  K  K  V  P  L  A  P      p.12920

          .         .         .  | 200     .         .         .    g.182707
 CCTAAAAAGCCTGAAGTCCCACCTGTTAAAG | TGCCAGAGGCTCCCAAAGAAGTTGTTCCT    c.38820
 P  K  K  P  E  V  P  P  V  K  V |   P  E  A  P  K  E  V  V  P      p.12940

          .         .         .         .         .      | 201 .    g.182876
 GAAAAGAAAGTGCCAGTGACTCCTCCTAAAAAACCTGAAGTCCCACCTGTTAAAG | TGCCA    c.38880
 E  K  K  V  P  V  T  P  P  K  K  P  E  V  P  P  V  K  V |   P      p.12960

          .         .         .         .         .         .       g.182936
 GAGGCTCCCATAGAGGTTGTTCCTGAAAAGAAAATGCCCTTGGCTCCTCCTAAAAAGCCT       c.38940
 E  A  P  I  E  V  V  P  E  K  K  M  P  L  A  P  P  K  K  P         p.12980

          .          | 202       .         .         .         .    g.183107
 GAAGTCCCTCCTGTTAAAG | TACCAGAGGCTCCCAAAGAGGTTGTTCCTGAAAAGAAAGTG    c.39000
 E  V  P  P  V  K  V |   P  E  A  P  K  E  V  V  P  E  K  K  V      p.13000

          .         .         .         .    | 203   .         .    g.183278
 CCCTCGGCTCCTCCTAAAAAGCCTGAAGTCCCACCTGTTAAAG | TGCCAGAGGCTCCGAAA    c.39060
 P  S  A  P  P  K  K  P  E  V  P  P  V  K  V |   P  E  A  P  K      p.13020

          .         .         .         .         .         .       g.183338
 GAAGTTGTTCCTGAAAAGAAAGTGCCAGCGGCTCCTCCTAAAAAGCCTGAAGTCACACCT       c.39120
 E  V  V  P  E  K  K  V  P  A  A  P  P  K  K  P  E  V  T  P         p.13040

         | 204         .         .         .         .         .    g.183508
 GTTAAAG | TGCCTGAGGCTCCCAAAGAAGTTGTTCCTGAAAAGAAAGTGCCAGTGCCTCCT    c.39180
 V  K  V |   P  E  A  P  K  E  V  V  P  E  K  K  V  P  V  P  P      p.13060

          .         .         .  | 205     .         .         .    g.183652
 CCTAAAAAGCCTGAAGTGCCACCCACAAAAG | TCCCAGAGGTGCCAAAGGTAGCTGTCCCA    c.39240
 P  K  K  P  E  V  P  P  T  K  V |   P  E  V  P  K  V  A  V  P      p.13080

          .         .         .         .         .      | 206 .    g.183840
 GAAAAGAAGGTGCCTGAAGCTATTCCTCCCAAACCGGAAAGTCCTCCCCCTGAAG | TGTTC    c.39300
 E  K  K  V  P  E  A  I  P  P  K  P  E  S  P  P  P  E  V |   F      p.13100

          .         .         .         .         .         .       g.183900
 GAGGAGCCTGAGGAAGTTGCCCTAGAAGAGCCTCCTGCTGAAGTTGTGGAAGAGCCAGAG       c.39360
 E  E  P  E  E  V  A  L  E  E  P  P  A  E  V  V  E  E  P  E         p.13120

          .          | 207       .         .         .         .    g.184094
 CCAGCGGCGCCTCCACAAG | TGACCGTACCACCTAAGAAACCTGTCCCAGAAAAGAAAGCA    c.39420
 P  A  A  P  P  Q  V |   T  V  P  P  K  K  P  V  P  E  K  K  A      p.13140

          .         .         .         .    | 208   .         .    g.184283
 CCTGCTGTCGTTGCCAAAAAACCTGAACTACCACCAGTGAAAG | TGCCCGAGGTGCCCAAG    c.39480
 P  A  V  V  A  K  K  P  E  L  P  P  V  K  V |   P  E  V  P  K      p.13160

          .         .         .         .         .         .       g.184343
 GAGGTTGTTCCTGAAAAGAAGGTGCCTCTGGTGGTTCCCAAAAAGCCAGAAGCCCCACCT       c.39540
 E  V  V  P  E  K  K  V  P  L  V  V  P  K  K  P  E  A  P  P         p.13180

         | 209         .         .         .         .         .    g.184535
 GCTAAAG | TGCCTGAAGTTCCAAAAGAAGTTGTTCCAGAAAAGAAAGTAGCTGTTCCCAAA    c.39600
 A  K  V |   P  E  V  P  K  E  V  V  P  E  K  K  V  A  V  P  K      p.13200

          .         .      | 210 .         .         .         .    g.185003
 AAGCCAGAAGTCCCACCAGCAAAAG | TGCCAGAAGTGCCAAAGAAACCTGTCTTGGAAGAG    c.39660
 K  P  E  V  P  P  A  K  V |   P  E  V  P  K  K  P  V  L  E  E      p.13220

          .         .         .         .          | 211       .    g.185542
 AAACCAGCTGTTCCTGTTCCAGAAAGAGCGGAGTCTCCTCCCCCAGAAG | TATATGAAGAA    c.39720
 K  P  A  V  P  V  P  E  R  A  E  S  P  P  P  E  V |   Y  E  E      p.13240

          .         .         .         .         .         .       g.185602
 CCTGAGGAAATTGCTCCTGAAGAGGAAATTGCTCCTGAAGAGGAAAAGCCAGTTCCTGTT       c.39780
 P  E  E  I  A  P  E  E  E  I  A  P  E  E  E  K  P  V  P  V         p.13260

          .         .         .        | 212         .         .    g.185931
 GCAGAAGAGGAGGAACCAGAGGTTCCACCTCCAGCAG | TGCCTGAAGAGCCCAAGAAGATC    c.39840
 A  E  E  E  E  P  E  V  P  P  P  A  V |   P  E  E  P  K  K  I      p.13280

          .         .         .         .         .      | 213 .    g.186176
 ATCCCAGAGAAGAAAGTTCCTGTCATCAAAAAACCAGAAGCACCGCCTCCTAAAG | AACCT    c.39900
 I  P  E  K  K  V  P  V  I  K  K  P  E  A  P  P  P  K  E |   P      p.13300

          .         .         .         .         .         .       g.186236
 GAGATGCCAAAGAAAGTTGTTCCAGTGAAGAAGGTCCCAACTGTTAAGAAGCCAGAAACA       c.39960
 E  M  P  K  K  V  V  P  V  K  K  V  P  T  V  K  K  P  E  T         p.13320

          .    | 214   .         .         .         .         .    g.186518
 CCAGCAGCTAAAG | TGCCTGAGGTGCCCAAGAAACTTGTTCCAGTAAAGAAAGAACCTGTG    c.40020
 P  A  A  K  V |   P  E  V  P  K  K  L  V  P  V  K  K  E  P  V      p.13340

          .         .         .        | 215         .         .    g.188361
 CCTGTTACCAAAAAACCAGAAGTTCTTCCAGAAAAAG | TGCCCAAAGTGCCTGAGAAAATC    c.40080
 P  V  T  K  K  P  E  V  L  P  E  K  V |   P  K  V  P  E  K  I      p.13360

          .         .         .         .         .         .       g.188421
 ATCCCAGAAAAGGAAGTGTCTGTGCCTATCCCTGCAGAGCCAGAAGTTCCACCTGCTGAA       c.40140
 I  P  E  K  E  V  S  V  P  I  P  A  E  P  E  V  P  P  A  E         p.13380

   | 216     .         .         .         .         .         .    g.188717
 G | TTGAAGAGACTCCTGAGGAAATAATATATGAAGAAAAAGCATCTATAACCATTGGTAGA    c.40200
 V |   E  E  T  P  E  E  I  I  Y  E  E  K  A  S  I  T  I  G  R      p.13400

          .         .   | 217    .         .         .         .    g.189281
 AAAGAGACTCCCCCTGTTGAAG | AACGTGAAATTGAAAAGTATATTAAACCTGAAGAGCCC    c.40260
 K  E  T  P  P  V  E  E |   R  E  I  E  K  Y  I  K  P  E  E  P      p.13420

          .         .         .        | 218         .         .    g.189795
 GAACCTGAACCACAGCCTGAAGAAATACCAGTAAAAG | AACCTGAACCTGAAAAGGTTATT    c.40320
 E  P  E  P  Q  P  E  E  I  P  V  K  E |   P  E  P  E  K  V  I      p.13440

          .         .         .         .         .         .       g.189855
 GAGAAGCCAAAACTCAAACCAAGACCCCCACCTCCTCCACCTGCTCCACCTAAGGAAGAT       c.40380
 E  K  P  K  L  K  P  R  P  P  P  P  P  P  A  P  P  K  E  D         p.13460

          .         .         | 219        .         .         .    g.191218
 GTGAAGGAGAAAATATTCCAACTTAAAG | CTATTCCAAAGAAGAAAGTTCCTGAAAAACCT    c.40440
 V  K  E  K  I  F  Q  L  K  A |   I  P  K  K  K  V  P  E  K  P      p.13480

          .         .         .        | 220         .         .    g.193508
 CAGGTTCCAGAAAAAGTGGAGCTTACACCTCTGAAAG | TGCCTGGAGGTGAAAAGAAAGTT    c.40500
 Q  V  P  E  K  V  E  L  T  P  L  K  V |   P  G  G  E  K  K  V      p.13500

          .         .         .         .         .         | 221    g.194489
 CGCAAATTACTTCCGGAACGTAAACCTGAACCAAAGGAAGAAGTTGTTCTGAAAAGCG | TT    c.40560
 R  K  L  L  P  E  R  K  P  E  P  K  E  E  V  V  L  K  S  V |       p.13520

          .         .         .         .         .         .       g.194549
 CTAAGAAAAAGACCTGAAGAAGAAGAACCTAAAGTAGAACCTAAAAAACTAGAAAAAGTT       c.40620
 L  R  K  R  P  E  E  E  E  P  K  V  E  P  K  K  L  E  K  V         p.13540

          .    | 222   .         .         .         .         .    g.195219
 AAAAAACCTGCAG | TACCAGAACCACCACCTCCAAAACCTGTTGAAGAGGTTGAAGTACCT    c.40680
 K  K  P  A  V |   P  E  P  P  P  P  K  P  V  E  E  V  E  V  P      p.13560

          .         .         .         .    | 223   .         .    g.195709
 ACTGTTACAAAAAGGGAAAGGAAGATTCCTGAACCAACAAAAG | TGCCTGAAATCAAGCCA    c.40740
 T  V  T  K  R  E  R  K  I  P  E  P  T  K  V |   P  E  I  K  P      p.13580

          .         .         .         .       | 224.         .    g.196028
 GCAATACCTCTCCCTGCACCTGAACCGAAACCAAAGCCCGAAGCAG | AAGTGAAAACAATC    c.40800
 A  I  P  L  P  A  P  E  P  K  P  K  P  E  A  E |   V  K  T  I      p.13600

          .         .         .         .         .         .       g.196088
 AAACCACCTCCTGTGGAACCTGAACCAACCCCCATCGCTGCCCCAGTAACAGTGCCAGTG       c.40860
 K  P  P  P  V  E  P  E  P  T  P  I  A  A  P  V  T  V  P  V         p.13620

          .       | 225.         .         .         .         .    g.198427
 GTTGGAAAGAAAGCAG | AAGCCAAAGCACCTAAGGAAGAGGCTGCCAAGCCAAAAGGTCCT    c.40920
 V  G  K  K  A  E |   A  K  A  P  K  E  E  A  A  K  P  K  G  P      p.13640

         | 226         .         .         .         .         .    g.199056
 ATCAAAG | GTGTACCCAAAAAGACTCCTTCACCAATAGAAGCCGAAAGGAGAAAGTTAAGG    c.40980
 I  K  G |   V  P  K  K  T  P  S  P  I  E  A  E  R  R  K  L  R      p.13660

          .         .         .         .         .         .       g.199116
 CCAGGAAGTGGTGGAGAGAAACCTCCTGATGAAGCCCCGTTCACCTACCAGCTAAAGGCT       c.41040
 P  G  S  G  G  E  K  P  P  D  E  A  P  F  T  Y  Q  L  K  A         p.13680

          .         .         .         .         .         .       g.199176
 GTGCCACTGAAGTTTGTGAAAGAAATCAAAGACATCATCTTGACAGAATCAGAGTTCGTT       c.41100
 V  P  L  K  F  V  K  E  I  K  D  I  I  L  T  E  S  E  F  V         p.13700

          .         .         .         .         .         .       g.199236
 GGCTCTTCAGCAATCTTTGAATGTTTGGTCTCCCCTTCCACTGCAATTACAACCTGGATG       c.41160
 G  S  S  A  I  F  E  C  L  V  S  P  S  T  A  I  T  T  W  M         p.13720

          .         .         .         .         .         .       g.199296
 AAAGACGGTAGCAATATCCGTGAGAGTCCCAAGCACAGGTTTATTGCAGATGGTAAAGAC       c.41220
 K  D  G  S  N  I  R  E  S  P  K  H  R  F  I  A  D  G  K  D         p.13740

          .         .         .         .         .         .       g.199356
 AGAAAGCTGCACATCATTGATGTTCAACTTTCCGATGCTGGTGAATACACCTGTGTTTTA       c.41280
 R  K  L  H  I  I  D  V  Q  L  S  D  A  G  E  Y  T  C  V  L         p.13760

          .         .         .         .          | 227       .    g.199572
 CGTTTGGGAAACAAAGAAAAGACCTCCACGGCTAAACTTGTTGTAGAAG | AACTTCCTGTG    c.41340
 R  L  G  N  K  E  K  T  S  T  A  K  L  V  V  E  E |   L  P  V      p.13780

          .         .         .         .         .         .       g.199632
 CGTTTTGTAAAAACACTGGAAGAGGAAGTCACAGTGGTCAAAGGACAGCCATTGTACTTG       c.41400
 R  F  V  K  T  L  E  E  E  V  T  V  V  K  G  Q  P  L  Y  L         p.13800

          .         .         .         .         .         .       g.199692
 AGCTGCGAGTTAAACAAAGAGCGTGACGTGGTCTGGAGGAAGGATGGCAAGATTGTGGTG       c.41460
 S  C  E  L  N  K  E  R  D  V  V  W  R  K  D  G  K  I  V  V         p.13820

          .         .         .         .         .         .       g.199752
 GAGAAACCTGGCCGAATTGTGCCAGGCGTCATTGGCTTGATGCGGGCTCTGACCATCAAC       c.41520
 E  K  P  G  R  I  V  P  G  V  I  G  L  M  R  A  L  T  I  N         p.13840

          .         .         .         .         .         .       g.199812
 GATGCAGATGACACAGATGCTGGAACATACACAGTTACTGTGGAAAACGCCAACAACCTG       c.41580
 D  A  D  D  T  D  A  G  T  Y  T  V  T  V  E  N  A  N  N  L         p.13860

          .         .         | 228        .         .         .    g.200119
 GAGTGTTCATCTTGCGTAAAAGTAGTAG | AAGTCATTAGAGATTGGCTGGTGAAACCTATA    c.41640
 E  C  S  S  C  V  K  V  V  E |   V  I  R  D  W  L  V  K  P  I      p.13880

          .         .         .         .         .         .       g.200179
 CGAGACCAGCATGTGAAACCCAAGGGGACAGCTATTTTTGCCTGTGATATAGCAAAAGAT       c.41700
 R  D  Q  H  V  K  P  K  G  T  A  I  F  A  C  D  I  A  K  D         p.13900

          .         .         .         .         .         .       g.200239
 ACTCCAAACATTAAGTGGTTCAAAGGATATGATGAAATCCCTGCGGAACCAAATGATAAG       c.41760
 T  P  N  I  K  W  F  K  G  Y  D  E  I  P  A  E  P  N  D  K         p.13920

          .         .         .         .         .         .       g.200299
 ACTGAAATACTGAGAGATGGAAATCATCTGTACCTCAAAATTAAGAATGCTATGCCAGAA       c.41820
 T  E  I  L  R  D  G  N  H  L  Y  L  K  I  K  N  A  M  P  E         p.13940

          .         .         .         .         .         .       g.200359
 GATATTGCTGAGTATGCAGTGGAAATTGAAGGAAAAAGATACCCTGCAAAGCTGACACTT       c.41880
 D  I  A  E  Y  A  V  E  I  E  G  K  R  Y  P  A  K  L  T  L         p.13960

      | 229  .         .         .         .         .         .    g.200554
 GGAG | AGCGTGAAGTTGAACTGCTTAAACCAATAGAGGACGTTACCATTTATGAGAAAGAA    c.41940
 G  E |   R  E  V  E  L  L  K  P  I  E  D  V  T  I  Y  E  K  E      p.13980

          .         .         .         .         .         .       g.200614
 AGTGCAAGCTTTGATGCAGAAATCTCAGAGGCAGACATTCCTGGACAATGGAAACTGAAA       c.42000
 S  A  S  F  D  A  E  I  S  E  A  D  I  P  G  Q  W  K  L  K         p.14000

          .         .     | 230  .         .         .         .    g.200989
 GGAGAACTTCTAAGGCCCTCACCT | ACTTGTGAAATCAAAGCAGAAGGTGGAAAACGCTTC    c.42060
 G  E  L  L  R  P  S  P   | T  C  E  I  K  A  E  G  G  K  R  F      p.14020

          .         .         .         .         .         .       g.201049
 TTAACTTTGCACAAAGTCAAACTGGACCAAGCTGGTGAAGTCCTCTACCAGGCCCTTAAT       c.42120
 L  T  L  H  K  V  K  L  D  Q  A  G  E  V  L  Y  Q  A  L  N         p.14040

          .         .         .  | 231     .         .         .    g.201202
 GCAATTACAACTGCCATTTTGACAGTAAAAG | AAATCGAACTTGACTTTGCTGTGCCCCTG    c.42180
 A  I  T  T  A  I  L  T  V  K  E |   I  E  L  D  F  A  V  P  L      p.14060

          .         .         .         .         .         .       g.201262
 AAGGATGTCACTGTTCCAGAAAGGCGACAGGCTCGATTCGAATGTGTCCTCACCCGAGAG       c.42240
 K  D  V  T  V  P  E  R  R  Q  A  R  F  E  C  V  L  T  R  E         p.14080

          .         .         .         .         .         .       g.201322
 GCAAATGTTATATGGTCCAAAGGACCTGATATAATTAAGTCATCTGACAAATTTGATATC       c.42300
 A  N  V  I  W  S  K  G  P  D  I  I  K  S  S  D  K  F  D  I         p.14100

          .         .         .         .         .         .       g.201382
 ATCGCTGATGGAAAGAAACATATTCTTGTTATTAATGATTCTCAATTTGATGATGAAGGG       c.42360
 I  A  D  G  K  K  H  I  L  V  I  N  D  S  Q  F  D  D  E  G         p.14120

          .         .         .         .         .      | 232 .    g.201724
 GTCTATACTGCTGAGGTGGAGGGCAAGAAGACCTCAGCTCGGTTGTTTGTCACAG | GTATA    c.42420
 V  Y  T  A  E  V  E  G  K  K  T  S  A  R  L  F  V  T  G |   I      p.14140

          .         .         .         .         .         .       g.201784
 AGACTGAAATTCATGTCACCTCTTGAAGATCAAACAGTAAAAGAAGGTGAAACAGCAACT       c.42480
 R  L  K  F  M  S  P  L  E  D  Q  T  V  K  E  G  E  T  A  T         p.14160

          .         .         .         .         .         .       g.201844
 TTTGTTTGTGAACTTTCTCATGAAAAAATGCATGTAGTCTGGTTCAAAAATGATGCCAAA       c.42540
 F  V  C  E  L  S  H  E  K  M  H  V  V  W  F  K  N  D  A  K         p.14180

          .         .         .         .         .         .       g.201904
 CTCCATACAAGCAGAACAGTACTCATCTCTTCTGAGGGCAAGACTCACAAATTGGAAATG       c.42600
 L  H  T  S  R  T  V  L  I  S  S  E  G  K  T  H  K  L  E  M         p.14200

          .         .         .         .         .         .       g.201964
 AAAGAAGTGACATTGGATGATATATCTCAGATAAAAGCTCAAGTCAAGGAGCTGAGCTCC       c.42660
 K  E  V  T  L  D  D  I  S  Q  I  K  A  Q  V  K  E  L  S  S         p.14220

          .         .   | 233    .         .         .         .    g.202164
 ACAGCACAGCTGAAGGTCTTAG | AGGCCGATCCCTACTTCACTGTGAAATTACATGACAAA    c.42720
 T  A  Q  L  K  V  L  E |   A  D  P  Y  F  T  V  K  L  H  D  K      p.14240

          .         .         .         .         .         .       g.202224
 ACTGCAGTGGAGAAGGATGAGATTACTTTGAAGTGTGAAGTGAGCAAAGATGTACCAGTG       c.42780
 T  A  V  E  K  D  E  I  T  L  K  C  E  V  S  K  D  V  P  V         p.14260

          .         .         .         .         .         .       g.202284
 AAATGGTTCAAAGATGGTGAAGAGATTGTCCCTTCACCCAAATATTCTATCAAGGCAGAT       c.42840
 K  W  F  K  D  G  E  E  I  V  P  S  P  K  Y  S  I  K  A  D         p.14280

          .         .         .         .         .         .       g.202344
 GGCCTGCGCCGCATCTTAAAAATCAAAAAGGCGGACCTTAAAGATAAAGGCGAATATGTG       c.42900
 G  L  R  R  I  L  K  I  K  K  A  D  L  K  D  K  G  E  Y  V         p.14300

          .         .         .         .       | 234.         .    g.202490
 TGTGACTGTGGCACAGACAAGACCAAGGCAAATGTTACTGTTGAGG | CTCGACTAATAAAA    c.42960
 C  D  C  G  T  D  K  T  K  A  N  V  T  V  E  A |   R  L  I  K      p.14320

          .         .         .         .         .         .       g.202550
 GTGGAAAAGCCTCTGTACGGAGTAGAGGTGTTTGTTGGTGAAACAGCCCACTTTGAAATT       c.43020
 V  E  K  P  L  Y  G  V  E  V  F  V  G  E  T  A  H  F  E  I         p.14340

          .         .         .         .         .         .       g.202610
 GAACTTTCTGAACCTGATGTTCACGGCCAGTGGAAGCTGAAAGGACAGCCTTTGACAGCT       c.43080
 E  L  S  E  P  D  V  H  G  Q  W  K  L  K  G  Q  P  L  T  A         p.14360

        | 235.         .         .         .         .         .    g.202812
 TCCCCT | GACTGTGAAATCATTGAGGATGGAAAGAAGCATATTCTGATCCTTCATAACTGT    c.43140
 S  P   | D  C  E  I  I  E  D  G  K  K  H  I  L  I  L  H  N  C      p.14380

          .         .         .         .         .         .       g.202872
 CAGCTGGGTATGACAGGAGAGGTTTCCTTCCAGGCTGCTAATGCCAAATCTGCAGCCAAT       c.43200
 Q  L  G  M  T  G  E  V  S  F  Q  A  A  N  A  K  S  A  A  N         p.14400

          .    | 236   .         .         .         .         .    g.203057
 CTGAAAGTGAAAG | AATTGCCTCTTATCTTCATCACACCTCTCAGTGATGTTAAAGTCTTC    c.43260
 L  K  V  K  E |   L  P  L  I  F  I  T  P  L  S  D  V  K  V  F      p.14420

          .         .         .         .         .         .       g.203117
 GAGAAAGATGAGGCTAAGTTTGAGTGTGAAGTATCCAGGGAGCCCAAAACATTCCGTTGG       c.43320
 E  K  D  E  A  K  F  E  C  E  V  S  R  E  P  K  T  F  R  W         p.14440

          .         .         .         .         .         .       g.203177
 CTAAAAGGAACCCAGGAAATCACAGGTGATGACAGATTTGAGCTTATAAAGGATGGCACT       c.43380
 L  K  G  T  Q  E  I  T  G  D  D  R  F  E  L  I  K  D  G  T         p.14460

          .         .         .         .         .         .       g.203237
 AAGCATTCAATGGTGATCAAGTCAGCTGCTTTTGAAGATGAAGCAAAATACATGTTTGAA       c.43440
 K  H  S  M  V  I  K  S  A  A  F  E  D  E  A  K  Y  M  F  E         p.14480

          .         .         .         . | 237      .         .    g.203409
 GCTGAAGATAAGCACACAAGTGGCAAACTGATCATTGAAG | GAATCCGGCTCAAATTCCTC    c.43500
 A  E  D  K  H  T  S  G  K  L  I  I  E  G |   I  R  L  K  F  L      p.14500

          .         .         .         .         .         .       g.203469
 ACCCCTCTCAAAGATGTAACTGCCAAAGAGAAGGAAAGTGCTGTATTTACTGTGGAGTTA       c.43560
 T  P  L  K  D  V  T  A  K  E  K  E  S  A  V  F  T  V  E  L         p.14520

          .         .         .         .         .         .       g.203529
 TCTCATGATAACATCCGAGTTAAATGGTTCAAGAATGACCAGCGCCTACACACCACCAGG       c.43620
 S  H  D  N  I  R  V  K  W  F  K  N  D  Q  R  L  H  T  T  R         p.14540

          .         .         .         .         .         .       g.203589
 TCGGTCTCAATGCAAGACGAAGGGAAAACTCATTCGATCACATTCAAAGACCTGTCTATT       c.43680
 S  V  S  M  Q  D  E  G  K  T  H  S  I  T  F  K  D  L  S  I         p.14560

          .         .         .         .         .         .       g.203649
 GATGACACCTCCCAAATTAGAGTAGAAGCTATGGGGATGAGTTCAGAAGCTAAACTCACT       c.43740
 D  D  T  S  Q  I  R  V  E  A  M  G  M  S  S  E  A  K  L  T         p.14580

         | 238         .         .         .         .         .    g.204555
 GTGCTTG | AGGGAGACCCATATTTTACAGGAAAACTTCAAGATTATACTGGTGTAGAGAAA    c.43800
 V  L  E |   G  D  P  Y  F  T  G  K  L  Q  D  Y  T  G  V  E  K      p.14600

          .         .         .         .         .         .       g.204615
 GATGAAGTTATTCTACAGTGTGAAATTAGCAAAGCAGATGCACCAGTGAAATGGTTTAAG       c.43860
 D  E  V  I  L  Q  C  E  I  S  K  A  D  A  P  V  K  W  F  K         p.14620

          .         .         .         .         .         .       g.204675
 GATGGGAAGGAAATAAAGCCATCCAAAAATGCTGTTATTAAGGCAGATGGCAAGAAACGC       c.43920
 D  G  K  E  I  K  P  S  K  N  A  V  I  K  A  D  G  K  K  R         p.14640

          .         .         .         .         .         .       g.204735
 ATGCTAATCCTAAAGAAAGCCTTGAAATCAGATATTGGACAGTACACCTGTGACTGTGGG       c.43980
 M  L  I  L  K  K  A  L  K  S  D  I  G  Q  Y  T  C  D  C  G         p.14660

          .         .         .     | 239  .         .         .    g.204885
 ACAGATAAGACCTCAGGAAAACTTGACATTGAGG | ATCGGGAAATTAAACTGGTGCGACCC    c.44040
 T  D  K  T  S  G  K  L  D  I  E  D |   R  E  I  K  L  V  R  P      p.14680

          .         .         .         .         .         .       g.204945
 CTGCACAGTGTGGAGGTGATGGAGACTGAGACAGCACGCTTTGAAACCGAAATCTCTGAA       c.44100
 L  H  S  V  E  V  M  E  T  E  T  A  R  F  E  T  E  I  S  E         p.14700

          .         .         .         .         .     | 240  .    g.205441
 GATGATATCCACGCCAACTGGAAACTCAAGGGAGAGGCCCTACTCCAAACACCT | GATTGT    c.44160
 D  D  I  H  A  N  W  K  L  K  G  E  A  L  L  Q  T  P   | D  C      p.14720

          .         .         .         .         .         .       g.205501
 GAAATTAAGGAAGAAGGCAAAATACACTCCCTTGTTTTGCACAACTGTCGCCTGGACCAG       c.44220
 E  I  K  E  E  G  K  I  H  S  L  V  L  H  N  C  R  L  D  Q         p.14740

          .         .         .         .         .         .       g.205561
 ACGGGTGGGGTGGATTTCCAAGCTGCCAATGTTAAATCTAGTGCCCACCTCCGAGTTAAG       c.44280
 T  G  G  V  D  F  Q  A  A  N  V  K  S  S  A  H  L  R  V  K         p.14760

   | 241     .         .         .         .         .         .    g.206418
 C | CACGAGTAATTGGTCTTCTGAGGCCTTTAAAGGATGTCACCGTGACTGCAGGGGAAACA    c.44340
 P |   R  V  I  G  L  L  R  P  L  K  D  V  T  V  T  A  G  E  T      p.14780

          .         .         .         .         .         .       g.206478
 GCCACCTTCGACTGCGAGCTCTCCTACGAAGATATCCCAGTGGAATGGTATCTCAAAGGG       c.44400
 A  T  F  D  C  E  L  S  Y  E  D  I  P  V  E  W  Y  L  K  G         p.14800

          .         .     | 242  .         .         .         .    g.210442
 AAGAAACTAGAGCCCAGCGATAAG | GTGGTCCCACGTTCAGAAGGAAAAGTTCATACACTT    c.44460
 K  K  L  E  P  S  D  K   | V  V  P  R  S  E  G  K  V  H  T  L      p.14820

          .         .         .         .         .         .       g.210502
 ACTCTGAGGGATGTAAAGTTAGAAGATGCTGGGGAAGTCCAACTAACAGCAAAAGATTTC       c.44520
 T  L  R  D  V  K  L  E  D  A  G  E  V  Q  L  T  A  K  D  F         p.14840

          .         .         | 243        .         .         .    g.211103
 AAAACTCACGCCAACCTCTTTGTGAAAG | AACCCCCAGTTGAATTCACTAAGCCTCTTGAG    c.44580
 K  T  H  A  N  L  F  V  K  E |   P  P  V  E  F  T  K  P  L  E      p.14860

          .         .         .         .         .         .       g.211163
 GACCAGACGGTCGAAGAGGGAGCCACTGCAGTGCTGGAGTGTGAAGTCTCCAGAGAAAAT       c.44640
 D  Q  T  V  E  E  G  A  T  A  V  L  E  C  E  V  S  R  E  N         p.14880

          .         .         .         .         .         .       g.211223
 GCTAAGGTGAAATGGTTCAAAAATGGGACAGAAATCCTCAAAAGCAAGAAGTATGAAATT       c.44700
 A  K  V  K  W  F  K  N  G  T  E  I  L  K  S  K  K  Y  E  I         p.14900

          .         .         .         .         .         .       g.211283
 GTTGCTGATGGCAGGGTCAGAAAACTTGTTATACATGACTGTACCCCAGAGGATATTAAA       c.44760
 V  A  D  G  R  V  R  K  L  V  I  H  D  C  T  P  E  D  I  K         p.14920

          .         .         .         .         .      | 244 .    g.213040
 ACATACACTTGTGATGCTAAGGATTTTAAGACTTCCTGTAACCTGAATGTCGTGC | CTCCT    c.44820
 T  Y  T  C  D  A  K  D  F  K  T  S  C  N  L  N  V  V  P |   P      p.14940

          .         .         .         .         .         .       g.213100
 CATGTGGAATTCTTAAGACCACTCACCGACCTTCAAGTTAGAGAAAAAGAAATGGCTCGA       c.44880
 H  V  E  F  L  R  P  L  T  D  L  Q  V  R  E  K  E  M  A  R         p.14960

          .         .         .    | 245   .         .         .    g.213821
 TTTGAGTGTGAACTTTCCCGAGAAAATGCTAAG | GTTAAGTGGTTTAAAGATGGTGCTGAA    c.44940
 F  E  C  E  L  S  R  E  N  A  K   | V  K  W  F  K  D  G  A  E      p.14980

          .         .         .         .         .         .       g.213881
 ATTAAAAAGGGCAAAAAATATGACATCATATCCAAGGGAGCAGTGCGCATTCTTGTCATC       c.45000
 I  K  K  G  K  K  Y  D  I  I  S  K  G  A  V  R  I  L  V  I         p.15000

          .         .         .         .         .         .       g.213941
 AACAAATGTCTACTGGATGATGAAGCTGAATATTCCTGTGAAGTAAGGACAGCGAGAACT       c.45060
 N  K  C  L  L  D  D  E  A  E  Y  S  C  E  V  R  T  A  R  T         p.15020

          .         .   | 246    .         .         .         .    g.214099
 TCTGGCATGCTGACAGTTCTGG | AAGAAGAAGCTGTCTTTACCAAAAATCTTGCCAACATT    c.45120
 S  G  M  L  T  V  L  E |   E  E  A  V  F  T  K  N  L  A  N  I      p.15040

          .         .         .         .         .         .       g.214159
 GAAGTTAGTGAAACAGACACTATAAAACTGGTTTGTGAAGTCTCCAAACCTGGCGCAGAA       c.45180
 E  V  S  E  T  D  T  I  K  L  V  C  E  V  S  K  P  G  A  E         p.15060

          .         .         .         .         .         .       g.214219
 GTGATTTGGTATAAAGGGGATGAGGAGATCATTGAAACAGGAAGATATGAAATACTGACT       c.45240
 V  I  W  Y  K  G  D  E  E  I  I  E  T  G  R  Y  E  I  L  T         p.15080

          .         .         .         .         .         .       g.214279
 GAAGGACGGAAGAGAATCCTGGTCATTCAGAACGCTCACCTTGAGGATGCTGGCAACTAC       c.45300
 E  G  R  K  R  I  L  V  I  Q  N  A  H  L  E  D  A  G  N  Y         p.15100

          .         .         .         .          | 247       .    g.214445
 AACTGTCGACTCCCAAGCTCTCGAACCGATGGCAAAGTCAAAGTACATG | AACTGGCTGCT    c.45360
 N  C  R  L  P  S  S  R  T  D  G  K  V  K  V  H  E |   L  A  A      p.15120

          .         .         .         .         .         .       g.214505
 GAATTTATCTCAAAGCCTCAAAACCTTGAAATACTTGAAGGAGAAAAGGCTGAATTTGTC       c.45420
 E  F  I  S  K  P  Q  N  L  E  I  L  E  G  E  K  A  E  F  V         p.15140

          .         .         .         .         .         .       g.214565
 TGCTCTATATCAAAAGAAAGCTTTCCAGTCCAGTGGAAGAGGGATGATAAGACACTTGAA       c.45480
 C  S  I  S  K  E  S  F  P  V  Q  W  K  R  D  D  K  T  L  E         p.15160

          .         .         .         .         .         .       g.214625
 TCTGGAGATAAATATGACGTTATTGCTGATGGTAAAAAGAGGGTCCTAGTTGTGAAAGAT       c.45540
 S  G  D  K  Y  D  V  I  A  D  G  K  K  R  V  L  V  V  K  D         p.15180

          .         .         .         .         .         .       g.214685
 GCCACATTACAAGATATGGGCACTTACGTTGTCATGGTAGGGGCCGCCAGAGCAGCAGCT       c.45600
 A  T  L  Q  D  M  G  T  Y  V  V  M  V  G  A  A  R  A  A  A         p.15200

          .       | 248.         .         .         .         .    g.214853
 CACTTGACAGTCATTG | AAAAACTCAGGATCGTAGTTCCTCTTAAGGACACCCGGGTGAAG    c.45660
 H  L  T  V  I  E |   K  L  R  I  V  V  P  L  K  D  T  R  V  K      p.15220

          .         .         .         .         .         .       g.214913
 GAACAACAGGAAGTTGTCTTCAACTGTGAAGTCAATACTGAAGGTGCCAAAGCCAAATGG       c.45720
 E  Q  Q  E  V  V  F  N  C  E  V  N  T  E  G  A  K  A  K  W         p.15240

          .         .         .         .         .         .       g.214973
 TTCAGAAATGAAGAAGCTATATTTGATAGTTCAAAATACATCATTCTCCAAAAAGACCTA       c.45780
 F  R  N  E  E  A  I  F  D  S  S  K  Y  I  I  L  Q  K  D  L         p.15260

          .         .         .         .         .         .       g.215033
 GTCTACACCCTCAGAATTAGAGATGCACACTTAGATGACCAAGCCAACTATAATGTGTCT       c.45840
 V  Y  T  L  R  I  R  D  A  H  L  D  D  Q  A  N  Y  N  V  S         p.15280

          .         .         .         .         .      | 249 .    g.215182
 TTGACCAATCACAGAGGTGAAAATGTTAAAAGTGCAGCCAATCTAATAGTAGAAG | AGGAA    c.45900
 L  T  N  H  R  G  E  N  V  K  S  A  A  N  L  I  V  E  E |   E      p.15300

          .         .         .         .         .         .       g.215242
 GACCTTAGGATTGTTGAGCCTCTTAAAGATATTGAAACAATGGAGAAGAAATCTGTCACA       c.45960
 D  L  R  I  V  E  P  L  K  D  I  E  T  M  E  K  K  S  V  T         p.15320

          .         .         .         .         .         .       g.215302
 TTCTGGTGCAAGGTGAATCGTCTCAATGTAACACTGAAGTGGACCAAAAATGGTGAAGAA       c.46020
 F  W  C  K  V  N  R  L  N  V  T  L  K  W  T  K  N  G  E  E         p.15340

          .         .         .         .         .         .       g.215362
 GTGCCTTTTGACAACCGTGTCTCATACAGAGTTGATAAGTACAAGCACATGTTAACCATT       c.46080
 V  P  F  D  N  R  V  S  Y  R  V  D  K  Y  K  H  M  L  T  I         p.15360

          .         .         .         .         .         .       g.215422
 AAAGACTGTGGCTTCCCAGATGAAGGTGAATACATTGTCACTGCTGGACAAGATAAATCT       c.46140
 K  D  C  G  F  P  D  E  G  E  Y  I  V  T  A  G  Q  D  K  S         p.15380

          .         .         .         .         .         .       g.215482
 GTTGCTGAGCTTCTCATCATAGAAGCCCCGACAGAATTTGTGGAACACTTGGAAGATCAG       c.46200
 V  A  E  L  L  I  I  E  A  P  T  E  F  V  E  H  L  E  D  Q         p.15400

          .         .         .         .         .         .       g.215542
 ACAGTCACTGAGTTCGATGACGCTGTCTTCTCCTGCCAGCTCTCCAGAGAGAAAGCCAAT       c.46260
 T  V  T  E  F  D  D  A  V  F  S  C  Q  L  S  R  E  K  A  N         p.15420

          .         .         .         .     | 250  .         .    g.215706
 GTAAAATGGTACAGAAATGGGAGAGAAATCAAAGAAGGCAAAAA | ATACAAATTTGAAAAA    c.46320
 V  K  W  Y  R  N  G  R  E  I  K  E  G  K  K  |  Y  K  F  E  K      p.15440

          .         .         .         .         .         .       g.215766
 GATGGAAGTATACACAGACTCATTATAAAAGATTGCAGGCTGGATGATGAGTGTGAATAT       c.46380
 D  G  S  I  H  R  L  I  I  K  D  C  R  L  D  D  E  C  E  Y         p.15460

          .         .         .         .          | 251       .    g.215926
 GCTTGCGGGGTAGAAGACAGGAAGTCTCGTGCTAGACTTTTTGTGGAAG | AAATTCCTGTT    c.46440
 A  C  G  V  E  D  R  K  S  R  A  R  L  F  V  E  E |   I  P  V      p.15480

          .         .         .         .         .         .       g.215986
 GAGATCATCAGGCCTCCACAAGATATTCTTGAAGCCCCTGGTGCTGATGTTGTCTTTTTA       c.46500
 E  I  I  R  P  P  Q  D  I  L  E  A  P  G  A  D  V  V  F  L         p.15500

          .         .         .         .         .         .       g.216046
 GCAGAACTCAATAAAGATAAGGTGGAAGTCCAATGGCTAAGAAATAACATGGTTGTTGTC       c.46560
 A  E  L  N  K  D  K  V  E  V  Q  W  L  R  N  N  M  V  V  V         p.15520

          .         .         .         .         .         .       g.216106
 CAGGGTGATAAACACCAGATGATGAGTGAAGGAAAGATACATCGACTACAGATTTGTGAT       c.46620
 Q  G  D  K  H  Q  M  M  S  E  G  K  I  H  R  L  Q  I  C  D         p.15540

          .         .         .         .         .         .       g.216166
 ATTAAGCCCCGTGACCAGGGTGAATACAGATTTATTGCCAAAGACAAAGAAGCCAGAGCT       c.46680
 I  K  P  R  D  Q  G  E  Y  R  F  I  A  K  D  K  E  A  R  A         p.15560

          .       | 252.         .         .         .         .    g.216993
 AAGCTTGAACTGGCAG | CTGCACCAAAAATCAAGACAGCTGACCAAGACCTTGTGGTTGAT    c.46740
 K  L  E  L  A  A |   A  P  K  I  K  T  A  D  Q  D  L  V  V  D      p.15580

          .         .         .         .         .         .       g.217053
 GTTGGCAAGCCTCTGACAATGGTGGTGCCATATGATGCCTACCCCAAAGCAGAAGCTGAA       c.46800
 V  G  K  P  L  T  M  V  V  P  Y  D  A  Y  P  K  A  E  A  E         p.15600

          .         .         .         .         .         .       g.217113
 TGGTTTAAAGAAAATGAACCTTTATCTACAAAAACCATTGATACTACGGCTGAACAAACT       c.46860
 W  F  K  E  N  E  P  L  S  T  K  T  I  D  T  T  A  E  Q  T         p.15620

          .         .         .         .         .         .       g.217173
 TCTTTCAGAATTTTAGAAGCCAAGAAAGGAGACAAAGGGAGGTATAAAATTGTGCTTCAG       c.46920
 S  F  R  I  L  E  A  K  K  G  D  K  G  R  Y  K  I  V  L  Q         p.15640

          .         .         .         .       | 253.         .    g.217325
 AACAAACATGGAAAAGCAGAAGGATTCATCAATTTAAAAGTTATTG | ATGTTCCTGGGCCA    c.46980
 N  K  H  G  K  A  E  G  F  I  N  L  K  V  I  D |   V  P  G  P      p.15660

          .         .         .         .         .         .       g.217385
 GTACGTAACTTAGAAGTGACAGAAACATTTGATGGTGAAGTGAGCCTTGCTTGGGAAGAA       c.47040
 V  R  N  L  E  V  T  E  T  F  D  G  E  V  S  L  A  W  E  E         p.15680

          .         .         .         .         .         .       g.217445
 CCTTTAACTGATGGTGGAAGCAAAATCATAGGTTACGTTGTTGAAAGACGTGACATTAAG       c.47100
 P  L  T  D  G  G  S  K  I  I  G  Y  V  V  E  R  R  D  I  K         p.15700

          .         .         .         .         .         .       g.217505
 AGAAAGACCTGGGTTCTGGCCACAGACCGTGCAGAGAGTTGTGAGTTTACTGTCACTGGT       c.47160
 R  K  T  W  V  L  A  T  D  R  A  E  S  C  E  F  T  V  T  G         p.15720

          .         .         .         .         .         .       g.217565
 CTACAGAAAGGAGGAGTTGAGTACCTATTCCGTGTGAGTGCAAGAAACAGAGTTGGCACT       c.47220
 L  Q  K  G  G  V  E  Y  L  F  R  V  S  A  R  N  R  V  G  T         p.15740

          .         .         .         .          | 254       .    g.217732
 GGTGAGCCAGTAGAAACTGACAATCCTGTAGAAGCAAGGAGTAAATATG | ATGTTCCAGGC    c.47280
 G  E  P  V  E  T  D  N  P  V  E  A  R  S  K  Y  D |   V  P  G      p.15760

          .         .         .         .         .         .       g.217792
 CCTCCTTTGAATGTAACCATCACTGATGTGAATCGATTTGGTGTCTCACTGACATGGGAA       c.47340
 P  P  L  N  V  T  I  T  D  V  N  R  F  G  V  S  L  T  W  E         p.15780

          .         .         .         .         .         .       g.217852
 CCACCAGAGTATGATGGAGGTGCTGAGATCACAAACTACGTCATTGAATTAAGAGACAAG       c.47400
 P  P  E  Y  D  G  G  A  E  I  T  N  Y  V  I  E  L  R  D  K         p.15800

          .         .         .         .         .         .       g.217912
 ACTTCTATCAGGTGGGATACTGCCATGACTGTGAGAGCTGAAGACCTGTCTGCAACTGTT       c.47460
 T  S  I  R  W  D  T  A  M  T  V  R  A  E  D  L  S  A  T  V         p.15820

          .         .         .         .         .         .       g.217972
 ACTGATGTGGTAGAAGGACAGGAGTACAGTTTCCGAGTGAGAGCCCAAAATCGAATTGGA       c.47520
 T  D  V  V  E  G  Q  E  Y  S  F  R  V  R  A  Q  N  R  I  G         p.15840

          .         .         .         .         .   | 255    .    g.218298
 GTTGGAAAACCAAGTGCAGCCACACCCTTCGTCAAAGTTGCTGATCCAATTG | AGAGACCA    c.47580
 V  G  K  P  S  A  A  T  P  F  V  K  V  A  D  P  I  E |   R  P      p.15860

          .         .         .         .         .         .       g.218358
 AGTCCTCCTGTAAACCTAACTTCCTCAGATCAGACTCAGTCATCAGTTCAGCTCAAATGG       c.47640
 S  P  P  V  N  L  T  S  S  D  Q  T  Q  S  S  V  Q  L  K  W         p.15880

          .         .         .         .         .         .       g.218418
 GAACCTCCTCTGAAAGATGGAGGAAGCCCAATATTAGGCTATATAATTGAGCGATGCGAA       c.47700
 E  P  P  L  K  D  G  G  S  P  I  L  G  Y  I  I  E  R  C  E         p.15900

          .         .         .         .         .         .       g.218478
 GAAGGAAAAGATAATTGGATTCGTTGCAATATGAAACTTGTCCCTGAACTGACTTACAAG       c.47760
 E  G  K  D  N  W  I  R  C  N  M  K  L  V  P  E  L  T  Y  K         p.15920

  | 256      .         .         .         .         .         .    g.218628
  | GTTACCGGATTGGAAAAAGGAAATAAATATTTATATAGAGTATCTGCAGAAAATAAAGCT    c.47820
  | V  T  G  L  E  K  G  N  K  Y  L  Y  R  V  S  A  E  N  K  A      p.15940

          .         .         .         .         .      | 257 .    g.218794
 GGTGTTTCAGATCCATCTGAAATTCTTGGTCCTCTCACCGCTGACGATGCATTTG | TTGAA    c.47880
 G  V  S  D  P  S  E  I  L  G  P  L  T  A  D  D  A  F  V |   E      p.15960

          .         .         .         .         .         .       g.218854
 CCAACAATGGATTTAAGTGCATTTAAAGATGGTCTGGAAGTTATTGTCCCAAATCCTATC       c.47940
 P  T  M  D  L  S  A  F  K  D  G  L  E  V  I  V  P  N  P  I         p.15980

          .         .         .         .         .         .       g.218914
 ACGATCCTGGTTCCAAGTACAGGCTATCCAAGGCCAACTGCAACCTGGTGTTTTGGAGAT       c.48000
 T  I  L  V  P  S  T  G  Y  P  R  P  T  A  T  W  C  F  G  D         p.16000

          .         .         .         .         .         .       g.218974
 AAAGTACTAGAAACAGGGGACCGGGTGAAAATGAAGACCTTGTCTGCCTATGCCGAACTT       c.48060
 K  V  L  E  T  G  D  R  V  K  M  K  T  L  S  A  Y  A  E  L         p.16020

          .         .         .         .         .         .       g.219034
 GTCATTTCTCCAAGTGAACGTTCAGACAAGGGCATTTATACACTGAAATTAGAAAACCGT       c.48120
 V  I  S  P  S  E  R  S  D  K  G  I  Y  T  L  K  L  E  N  R         p.16040

          .         .         .         . | 258      .         .    g.219192
 GTGAAAACAATTTCTGGGGAAATTGATGTCAATGTAATTG | CTCGCCCAAGTGCACCCAAA    c.48180
 V  K  T  I  S  G  E  I  D  V  N  V  I  A |   R  P  S  A  P  K      p.16060

          .         .         .         .         .         .       g.219252
 GAATTGAAATTTGGTGATATAACCAAGGACTCAGTACATTTGACTTGGGAACCACCTGAT       c.48240
 E  L  K  F  G  D  I  T  K  D  S  V  H  L  T  W  E  P  P  D         p.16080

          .         .         .         .         .         .       g.219312
 GATGATGGAGGAAGTCCGTTAACTGGATACGTTGTTGAAAAACGAGAAGTCAGCCGGAAA       c.48300
 D  D  G  G  S  P  L  T  G  Y  V  V  E  K  R  E  V  S  R  K         p.16100

          .   | 259    .         .         .         .         .    g.220062
 ACATGGACTAAA | GTTATGGACTTTGTGACTGATCTAGAATTCACAGTTCCTGATCTTGTT    c.48360
 T  W  T  K   | V  M  D  F  V  T  D  L  E  F  T  V  P  D  L  V      p.16120

          .         .         .         .         .         .       g.220122
 CAAGGAAAAGAGTACTTATTTAAAGTTTGTGCTCGTAACAAATGTGGCCCTGGAGAACCT       c.48420
 Q  G  K  E  Y  L  F  K  V  C  A  R  N  K  C  G  P  G  E  P         p.16140

          .         .         .         . | 260      .         .    g.220338
 GCATATGTTGATGAACCTGTAAATATGTCAACTCCTGCAA | CGGTACCTGACCCACCAGAG    c.48480
 A  Y  V  D  E  P  V  N  M  S  T  P  A  T |   V  P  D  P  P  E      p.16160

          .         .         .         .         .         .       g.220398
 AATGTTAAATGGAGAGATCGAACAGCCAATAGCATCTTCTTAACATGGGATCCACCTAAA       c.48540
 N  V  K  W  R  D  R  T  A  N  S  I  F  L  T  W  D  P  P  K         p.16180

          .         .         .         .         .         .       g.220458
 AATGATGGTGGTTCACGCATCAAAGGATATATAGTTGAAAGATGTCCACGTGGTTCTGAT       c.48600
 N  D  G  G  S  R  I  K  G  Y  I  V  E  R  C  P  R  G  S  D         p.16200

          .         .         .         | 261        .         .    g.220856
 AAATGGGTTGCCTGTGGAGAACCTGTTGCAGAAACAAA | AATGGAAGTGACAGGTCTTGAG    c.48660
 K  W  V  A  C  G  E  P  V  A  E  T  K  |  M  E  V  T  G  L  E      p.16220

          .         .         .         .         .         .       g.220916
 GAAGGCAAATGGTATGCCTACCGCGTGAAGGCCTTAAACAGGCAGGGTGCTAGCAAACCA       c.48720
 E  G  K  W  Y  A  Y  R  V  K  A  L  N  R  Q  G  A  S  K  P         p.16240

          .         .         .         . | 262      .         .    g.221069
 AGCAGACCCACAGAGGAAATCCAGGCTGTGGACACACAAG | AGGCCCCAGAAATCTTCCTC    c.48780
 S  R  P  T  E  E  I  Q  A  V  D  T  Q  E |   A  P  E  I  F  L      p.16260

          .         .         .         .         .         .       g.221129
 GATGTGAAGCTCCTTGCTGGTCTCACTGTAAAAGCTGGGACCAAGATTGAACTTCCTGCC       c.48840
 D  V  K  L  L  A  G  L  T  V  K  A  G  T  K  I  E  L  P  A         p.16280

          .         .         .         .         .         .       g.221189
 ACCGTAACCGGAAAACCTGAACCTAAAATAACTTGGACAAAGGCTGATATGATTCTGAAG       c.48900
 T  V  T  G  K  P  E  P  K  I  T  W  T  K  A  D  M  I  L  K         p.16300

          .         .         .         .         .         .       g.221249
 CAGGACAAAAGAATTACCATTGAAAATGTCCCTAAGAAATCCACAGTGACTATTGTTGAT       c.48960
 Q  D  K  R  I  T  I  E  N  V  P  K  K  S  T  V  T  I  V  D         p.16320

          .         .         .         .         .         .       g.221309
 AGTAAGAGAAGTGACACTGGCACATATATCATTGAGGCTGTGAATGTGTGTGGCCGGGCC       c.49020
 S  K  R  S  D  T  G  T  Y  I  I  E  A  V  N  V  C  G  R  A         p.16340

          .         .         | 263        .         .         .    g.221486
 ACTGCTGTGGTGGAAGTGAACGTCTTAG | ATAAACCCGGACCACCAGCTGCCTTTGACATC    c.49080
 T  A  V  V  E  V  N  V  L  D |   K  P  G  P  P  A  A  F  D  I      p.16360

          .         .         .         .         .         .       g.221546
 ACAGATGTAACCAATGAGTCATGTCTTCTAACATGGAACCCACCACGCGATGATGGTGGA       c.49140
 T  D  V  T  N  E  S  C  L  L  T  W  N  P  P  R  D  D  G  G         p.16380

          .         .         .         .         .         .       g.221606
 TCTAAGATCACAAACTATGTTGTGGAGAGACGAGCAACTGATAGTGAAGTGTGGCACAAG       c.49200
 S  K  I  T  N  Y  V  V  E  R  R  A  T  D  S  E  V  W  H  K         p.16400

          .         .         .         .         .         .       g.221666
 CTCTCATCCACCGTCAAGGATACAAACTTCAAGGCCACCAAATTAATCCCCAATAAAGAG       c.49260
 L  S  S  T  V  K  D  T  N  F  K  A  T  K  L  I  P  N  K  E         p.16420

          .         .         .         .         .         .       g.221726
 TACATCTTCAGAGTTGCTGCAGAAAACATGTATGGTGTTGGTGAACCAGTTCAGGCCTCT       c.49320
 Y  I  F  R  V  A  A  E  N  M  Y  G  V  G  E  P  V  Q  A  S         p.16440

          .         .      | 264 .         .         .         .    g.221900
 CCAATAACAGCCAAATATCAGTTTG | ATCCACCTGGTCCTCCAACTCGCCTAGAACCTTCT    c.49380
 P  I  T  A  K  Y  Q  F  D |   P  P  G  P  P  T  R  L  E  P  S      p.16460

          .         .         .         .         .         .       g.221960
 GATATCACTAAAGACGCAGTGACTCTCACATGGTGTGAGCCAGATGATGATGGTGGCAGC       c.49440
 D  I  T  K  D  A  V  T  L  T  W  C  E  P  D  D  D  G  G  S         p.16480

          .         .         .         .         .         .       g.222020
 CCAATCACAGGATACTGGGTTGAAAGACTGGATCCTGATACAGATAAATGGGTTAGATGC       c.49500
 P  I  T  G  Y  W  V  E  R  L  D  P  D  T  D  K  W  V  R  C         p.16500

          .         .         .   | 265    .         .         .    g.222554
 AATAAGATGCCAGTAAAGGACACAACATACAG | AGTGAAAGGTCTCACTAATAAGAAAAAA    c.49560
 N  K  M  P  V  K  D  T  T  Y  R  |  V  K  G  L  T  N  K  K  K      p.16520

          .         .         .         .         .         .       g.222614
 TACAGATTCCGTGTGTTGGCTGAAAATCTTGCTGGACCTGGAAAACCAAGCAAATCAACT       c.49620
 Y  R  F  R  V  L  A  E  N  L  A  G  P  G  K  P  S  K  S  T         p.16540

          .         .         | 266        .         .         .    g.222762
 GAACCAATCTTAATAAAGGATCCCATAG | ATCCTCCATGGCCCCCTGGAAAACCAACTGTA    c.49680
 E  P  I  L  I  K  D  P  I  D |   P  P  W  P  P  G  K  P  T  V      p.16560

          .         .         .         .         .         .       g.222822
 AAAGATGTAGGCAAAACATCAGTAAGGTTGAATTGGACAAAACCAGAACATGATGGAGGT       c.49740
 K  D  V  G  K  T  S  V  R  L  N  W  T  K  P  E  H  D  G  G         p.16580

          .         .         .         .         .         .       g.222882
 GCAAAGATTGAGTCTTATGTCATTGAAATGCTGAAGACTGGAACAGATGAGTGGGTCAGA       c.49800
 A  K  I  E  S  Y  V  I  E  M  L  K  T  G  T  D  E  W  V  R         p.16600

          .         .         .         .         .         .       g.222942
 GTGGCGGAAGGGGTTCCCACCACTCAGCACTTGCTCCCAGGGCTCATGGAAGGACAGGAA       c.49860
 V  A  E  G  V  P  T  T  Q  H  L  L  P  G  L  M  E  G  Q  E         p.16620

          .         .         .         .         .         .       g.223002
 TACTCATTCCGAGTTAGAGCTGTGAATAAGGCTGGGGAAAGTGAACCCAGTGAACCCAGT       c.49920
 Y  S  F  R  V  R  A  V  N  K  A  G  E  S  E  P  S  E  P  S         p.16640

          .         .         | 267        .         .         .    g.223258
 GACCCTGTGCTTTGCCGGGAGAAGCTAT | ATCCTCCATCACCACCACGCTGGCTTGAAGTT    c.49980
 D  P  V  L  C  R  E  K  L  Y |   P  P  S  P  P  R  W  L  E  V      p.16660

          .         .         .         .         .         .       g.223318
 ATTAATATCACAAAAAATACAGCAGACCTAAAATGGACAGTTCCTGAGAAAGATGGAGGG       c.50040
 I  N  I  T  K  N  T  A  D  L  K  W  T  V  P  E  K  D  G  G         p.16680

          .         .         .         .         .         .       g.223378
 TCCCCCATCACCAACTACATTGTGGAAAAGAGAGACGTCAGGCGAAAAGGCTGGCAAACA       c.50100
 S  P  I  T  N  Y  I  V  E  K  R  D  V  R  R  K  G  W  Q  T         p.16700

          .         .         .         .         .         .       g.223438
 GTGGATACCACTGTCAAGGACACCAAGTGCACAGTCACCCCACTGACTGAGGGCTCTTTA       c.50160
 V  D  T  T  V  K  D  T  K  C  T  V  T  P  L  T  E  G  S  L         p.16720

          .         .         .         .         .         .       g.223498
 TATGTGTTCCGAGTTGCTGCAGAAAATGCTATAGGACAAAGCGACTACACCGAAATTGAG       c.50220
 Y  V  F  R  V  A  A  E  N  A  I  G  Q  S  D  Y  T  E  I  E         p.16740

          .         .         | 268        .         .         .    g.223672
 GACTCTGTGCTGGCCAAAGACACCTTTA | CCACTCCTGGACCACCCTACGCCCTGGCAGTG    c.50280
 D  S  V  L  A  K  D  T  F  T |   T  P  G  P  P  Y  A  L  A  V      p.16760

          .         .         .         .         .         .       g.223732
 GTTGATGTGACAAAACGACATGTTGACCTAAAGTGGGAGCCACCTAAAAATGATGGTGGA       c.50340
 V  D  V  T  K  R  H  V  D  L  K  W  E  P  P  K  N  D  G  G         p.16780

          .     | 269  .         .         .         .         .    g.223894
 AGACCAATACAGAG | ATATGTCATTGAGAAGAAAGAAAGGTTAGGTACCCGTTGGGTGAAA    c.50400
 R  P  I  Q  R  |  Y  V  I  E  K  K  E  R  L  G  T  R  W  V  K      p.16800

          .         .         .         .         .         .       g.223954
 GCTGGAAAGACTGCAGGACCTGACTGTAACTTCAGAGTAACTGATGTCATCGAAGGAACA       c.50460
 A  G  K  T  A  G  P  D  C  N  F  R  V  T  D  V  I  E  G  T         p.16820

          .         .         .         .         .         .       g.224014
 GAGGTCCAGTTTCAGGTTCGGGCTGAAAATGAAGCTGGAGTTGGCCACCCAAGTGAACCC       c.50520
 E  V  Q  F  Q  V  R  A  E  N  E  A  G  V  G  H  P  S  E  P         p.16840

          .         .         .  | 270     .         .         .    g.224154
 ACAGAAATCCTATCCATTGAAGATCCAACAA | GTCCTCCCTCACCACCCCTTGACCTACAT    c.50580
 T  E  I  L  S  I  E  D  P  T  S |   P  P  S  P  P  L  D  L  H      p.16860

          .         .         .         .         .         .       g.224214
 GTGACTGATGCTGGGAGAAAACACATTGCCATTGCTTGGAAGCCTCCAGAGAAAAATGGT       c.50640
 V  T  D  A  G  R  K  H  I  A  I  A  W  K  P  P  E  K  N  G         p.16880

          .         .         .         .         .         .       g.224274
 GGAAGTCCTATCATAGGATACCATGTTGAAATGTGTCCAGTAGGCACTGAGAAATGGATG       c.50700
 G  S  P  I  I  G  Y  H  V  E  M  C  P  V  G  T  E  K  W  M         p.16900

          .         .         .         .         .         .       g.224334
 AGAGTTAATTCTCGCCCAATAAAGGACTTGAAATTCAAGGTTGAAGAAGGTGTTGTTCCT       c.50760
 R  V  N  S  R  P  I  K  D  L  K  F  K  V  E  E  G  V  V  P         p.16920

          .         .         .         .         .         .       g.224394
 GACAAAGAATATGTCCTGAGAGTGAGAGCAGTCAATGCTATTGGTGTCAGCGAGCCATCT       c.50820
 D  K  E  Y  V  L  R  V  R  A  V  N  A  I  G  V  S  E  P  S         p.16940

          .         .         .        | 271         .         .    g.224554
 GAAATCTCTGAAAATGTGGTTGCCAAAGACCCAGACT | GCAAGCCAACAATTGACCTGGAG    c.50880
 E  I  S  E  N  V  V  A  K  D  P  D  C |   K  P  T  I  D  L  E      p.16960

          .         .         .         .         .         .       g.224614
 ACTCATGACATTATTGTTATTGAAGGTGAAAAGTTAAGCATTCCTGTTCCCTTCAGAGCT       c.50940
 T  H  D  I  I  V  I  E  G  E  K  L  S  I  P  V  P  F  R  A         p.16980

          .         .         .         .         .         .       g.224674
 GTCCCAGTTCCAACTGTTAGTTGGCATAAAGATGGCAAAGAAGTTAAAGCAAGTGATAGA       c.51000
 V  P  V  P  T  V  S  W  H  K  D  G  K  E  V  K  A  S  D  R         p.17000

          .         .         .         .         .         .       g.224734
 TTAACAATGAAGAATGATCACATCTCTGCACACCTTGAAGTTCCCAAGAGTGTCCGTGCA       c.51060
 L  T  M  K  N  D  H  I  S  A  H  L  E  V  P  K  S  V  R  A         p.17020

          .         .         .         .         .         .       g.224794
 GATGCCGGAATTTATACCATTACACTGGAGAATAAGCTCGGCTCAGCAACAGCCTCAATC       c.51120
 D  A  G  I  Y  T  I  T  L  E  N  K  L  G  S  A  T  A  S  I         p.17040

          .       | 272.         .         .         .         .    g.225457
 AATGTCAAAGTCATAG | GCCTACCTGGACCATGCAAAGATATTAAAGCAAGTGACATTACC    c.51180
 N  V  K  V  I  G |   L  P  G  P  C  K  D  I  K  A  S  D  I  T      p.17060

          .         .         .         .         .         .       g.225517
 AAGAGTTCTTGTAAGTTAACTTGGGAACCTCCAGAATTTGATGGTGGAACCCCAATTCTT       c.51240
 K  S  S  C  K  L  T  W  E  P  P  E  F  D  G  G  T  P  I  L         p.17080

          .         .         .         .         .         .       g.225577
 CATTATGTCCTGGAGCGCAGAGAAGCTGGGAGGAGAACATATATACCAGTCATGTCTGGT       c.51300
 H  Y  V  L  E  R  R  E  A  G  R  R  T  Y  I  P  V  M  S  G         p.17100

          .         .         .         .         .         .       g.225637
 GAGAACAAACTGTCATGGACTGTGAAGGATCTCATACCAAATGGTGAATACTTCTTCCGT       c.51360
 E  N  K  L  S  W  T  V  K  D  L  I  P  N  G  E  Y  F  F  R         p.17120

          .         .         .         .         .         .       g.225697
 GTTAAAGCAGTCAACAAGGTTGGTGGAGGAGAATATATTGAACTGAAAAATCCAGTCATT       c.51420
 V  K  A  V  N  K  V  G  G  G  E  Y  I  E  L  K  N  P  V  I         p.17140

          .       | 273.         .         .         .         .    g.225860
 GCTCAAGATCCAAAGC | AACCCCCTGATCCACCTGTAGATGTAGAGGTTCATAATCCTACA    c.51480
 A  Q  D  P  K  Q |   P  P  D  P  P  V  D  V  E  V  H  N  P  T      p.17160

          .         .         .         .         .         .       g.225920
 GCGGAGGCAATGACTATTACATGGAAGCCACCTTTGTATGATGGAGGGAGCAAGATAATG       c.51540
 A  E  A  M  T  I  T  W  K  P  P  L  Y  D  G  G  S  K  I  M         p.17180

          .         .         .         .         .         .       g.225980
 GGCTACATCATAGAGAAGATTGCTAAGGGTGAAGAAAGGTGGAAGAGATGCAATGAACAC       c.51600
 G  Y  I  I  E  K  I  A  K  G  E  E  R  W  K  R  C  N  E  H         p.17200

          .         .         .         .         .         .       g.226040
 CTGGTACCAATCCTGACCTATACAGCAAAAGGACTTGAAGAGGGGAAAGAGTACCAATTC       c.51660
 L  V  P  I  L  T  Y  T  A  K  G  L  E  E  G  K  E  Y  Q  F         p.17220

          .         .         .         .         .         .       g.226100
 CGTGTGCGAGCAGAGAACGCCGCGGGTATTAGTGAACCTTCTCGGGCTACTCCTCCAACC       c.51720
 R  V  R  A  E  N  A  A  G  I  S  E  P  S  R  A  T  P  P  T         p.17240

          .          | 274       .         .         .         .    g.226273
 AAAGCTGTAGATCCCATTG | ATGCCCCCAAAGTCATTCTGAGAACAAGCCTAGAAGTGAAA    c.51780
 K  A  V  D  P  I  D |   A  P  K  V  I  L  R  T  S  L  E  V  K      p.17260

          .         .         .         .         .         .       g.226333
 CGAGGTGATGAAATAGCACTTGATGCAAGTATTTCTGGATCACCTTACCCAACTATTACA       c.51840
 R  G  D  E  I  A  L  D  A  S  I  S  G  S  P  Y  P  T  I  T         p.17280

          .         .         .         .         .         .       g.226393
 TGGATAAAGGATGAAAATGTTATTGTACCAGAGGAAATTAAGAAGCGTGCAGCACCCTTG       c.51900
 W  I  K  D  E  N  V  I  V  P  E  E  I  K  K  R  A  A  P  L         p.17300

          .         .         .         .         .         .       g.226453
 GTTAGGAGAAGGAAGGGTGAAGTTCAAGAAGAAGAACCATTTGTCCTGCCTCTGACACAG       c.51960
 V  R  R  R  K  G  E  V  Q  E  E  E  P  F  V  L  P  L  T  Q         p.17320

          .         .         .         .         .         .       g.226513
 CGTTTGAGTATTGACAACAGCAAAAAGGGAGAATCTCAGCTACGCGTCCGAGATTCTCTC       c.52020
 R  L  S  I  D  N  S  K  K  G  E  S  Q  L  R  V  R  D  S  L         p.17340

          .         .         .         .         .         .       g.226573
 CGACCTGACCATGGTCTGTATATGATCAAAGTTGAAAATGACCACGGTATTGCAAAAGCT       c.52080
 R  P  D  H  G  L  Y  M  I  K  V  E  N  D  H  G  I  A  K  A         p.17360

          .         .   | 275    .         .         .         .    g.226932
 CCTTGTACTGTCAGTGTGTTAG | ATACACCGGGACCACCAATCAACTTTGTATTTGAAGAT    c.52140
 P  C  T  V  S  V  L  D |   T  P  G  P  P  I  N  F  V  F  E  D      p.17380

          .         .         .         .         .         .       g.226992
 ATCAGAAAGACCTCAGTCCTTTGTAAATGGGAACCACCCCTTGATGATGGTGGCAGTGAA       c.52200
 I  R  K  T  S  V  L  C  K  W  E  P  P  L  D  D  G  G  S  E         p.17400

          .         .         .         .         .         .       g.227052
 ATCATAAACTACACTTTGGAAAAGAAAGACAAGACAAAACCCGACTCAGAATGGATTGTT       c.52260
 I  I  N  Y  T  L  E  K  K  D  K  T  K  P  D  S  E  W  I  V         p.17420

          .         .         .         .         .         .       g.227112
 GTCACTTCAACACTTAGACATTGCAAATATTCAGTAACAAAACTGATTGAAGGAAAAGAG       c.52320
 V  T  S  T  L  R  H  C  K  Y  S  V  T  K  L  I  E  G  K  E         p.17440

          .         .         .         .         .         .       g.227172
 TACCTCTTCCGTGTAAGAGCTGAAAACAGATTTGGGCCAGGTCCACCATGTGTTTCAAAG       c.52380
 Y  L  F  R  V  R  A  E  N  R  F  G  P  G  P  P  C  V  S  K         p.17460

          .         .      | 276 .         .         .         .    g.227360
 CCACTTGTGGCTAAAGATCCATTTG | GACCACCTGATGCACCAGATAAGCCCATTGTGGAA    c.52440
 P  L  V  A  K  D  P  F  G |   P  P  D  A  P  D  K  P  I  V  E      p.17480

          .         .         .         .         .         .       g.227420
 GATGTTACCAGCAACAGTATGCTAGTGAAATGGAATGAACCAAAAGATAATGGAAGCCCC       c.52500
 D  V  T  S  N  S  M  L  V  K  W  N  E  P  K  D  N  G  S  P         p.17500

          .         .         .         .         .         .       g.227480
 ATTTTGGGTTACTGGCTTGAAAAACGTGAAGTTAACAGTACACATTGGTCTCGTGTCAAC       c.52560
 I  L  G  Y  W  L  E  K  R  E  V  N  S  T  H  W  S  R  V  N         p.17520

          .         .         .         .         .         .       g.227540
 AAAAGCCTTCTGAATGCCTTGAAAGCCAATGTAGATGGCTTATTAGAAGGACTCACCTAT       c.52620
 K  S  L  L  N  A  L  K  A  N  V  D  G  L  L  E  G  L  T  Y         p.17540

          .         .         .         .         .         .       g.227600
 GTCTTCAGAGTATGTGCTGAAAATGCAGCTGGACCTGGAAAGTTCAGTCCACCTTCAGAT       c.52680
 V  F  R  V  C  A  E  N  A  A  G  P  G  K  F  S  P  P  S  D         p.17560

          .         .      | 277 .         .         .         .    g.227756
 CCCAAAACAGCACATGATCCAATCT | CTCCTCCTGGGCCACCTATCCCAAGAGTCACTGAC    c.52740
 P  K  T  A  H  D  P  I  S |   P  P  G  P  P  I  P  R  V  T  D      p.17580

          .         .         .         .         .         .       g.227816
 ACAAGCTCTACAACTATTGAACTAGAATGGGAACCCCCAGCTTTCAATGGTGGTGGGGAA       c.52800
 T  S  S  T  T  I  E  L  E  W  E  P  P  A  F  N  G  G  G  E         p.17600

          .         .         .         .         .         .       g.227876
 ATTGTTGGCTATTTTGTTGATAAGCAGTTGGTTGGCACAAATGAATGGTCACGCTGCACA       c.52860
 I  V  G  Y  F  V  D  K  Q  L  V  G  T  N  E  W  S  R  C  T         p.17620

          .         .         .         .         .         .       g.227936
 GAGAAGATGATCAAGGTCCGTCAGTACACCGTCAAAGAAATCCGAGAGGGTGCTGATTAC       c.52920
 E  K  M  I  K  V  R  Q  Y  T  V  K  E  I  R  E  G  A  D  Y         p.17640

          .         .         .         .         .         .       g.227996
 AAACTTCGGGTGAGTGCTGTCAATGCCGCAGGGGAAGGACCGCCTGGAGAAACACAACCT       c.52980
 K  L  R  V  S  A  V  N  A  A  G  E  G  P  P  G  E  T  Q  P         p.17660

          .         .   | 278    .         .         .         .    g.228155
 GTTACTGTGGCTGAACCACAAG | AGCCTCCAGCTGTGGAACTGGATGTTTCTGTCAAGGGT    c.53040
 V  T  V  A  E  P  Q  E |   P  P  A  V  E  L  D  V  S  V  K  G      p.17680

          .         .         .         .         .         .       g.228215
 GGAATACAAATAATGGCTGGGAAGACTCTTAGAATTCCAGCTGTGGTGACTGGTCGCCCT       c.53100
 G  I  Q  I  M  A  G  K  T  L  R  I  P  A  V  V  T  G  R  P         p.17700

          .         .         .         .         .         .       g.228275
 GTACCTACAAAAGTATGGACCAAAGAAGAAGGGGAGCTGGATAAAGACCGTGTTGTAATA       c.53160
 V  P  T  K  V  W  T  K  E  E  G  E  L  D  K  D  R  V  V  I         p.17720

          .         .         .         .         .         .       g.228335
 GACAACGTTGGAACCAAATCTGAACTAATTATCAAGGATGCACTGCGAAAAGACCATGGC       c.53220
 D  N  V  G  T  K  S  E  L  I  I  K  D  A  L  R  K  D  H  G         p.17740

          .         .         .         .         .         .       g.228395
 AGATATGTGATTACAGCTACAAATAGCTGTGGTTCCAAATTTGCAGCAGCCAGGGTAGAA       c.53280
 R  Y  V  I  T  A  T  N  S  C  G  S  K  F  A  A  A  R  V  E         p.17760

         | 279         .         .         .         .         .    g.228541
 GTTTTTG | ATGTCCCTGGTCCAGTTCTTGACTTAAAACCTGTTGTAACAAACAGAAAAATG    c.53340
 V  F  D |   V  P  G  P  V  L  D  L  K  P  V  V  T  N  R  K  M      p.17780

          .         .         .         .         .         .       g.228601
 TGTCTACTTAACTGGTCTGATCCAGAAGATGATGGAGGAAGTGAAATAACAGGCTTTATC       c.53400
 C  L  L  N  W  S  D  P  E  D  D  G  G  S  E  I  T  G  F  I         p.17800

          .         .         .         .         .         .       g.228661
 ATTGAAAGAAAAGATGCCAAGATGCATACTTGGAGACAACCAATAGAGACTGAGAGATCT       c.53460
 I  E  R  K  D  A  K  M  H  T  W  R  Q  P  I  E  T  E  R  S         p.17820

          .         .         .         .         .         .       g.228721
 AAATGTGACATCACAGGTCTGCTTGAGGGACAAGAATATAAGTTCCGTGTTATTGCCAAG       c.53520
 K  C  D  I  T  G  L  L  E  G  Q  E  Y  K  F  R  V  I  A  K         p.17840

          .         .         .         .         .         .       g.228781
 AACAAGTTTGGCTGTGGCCCTCCTGTTGAAATAGGACCAATTCTTGCAGTTGATCCACTA       c.53580
 N  K  F  G  C  G  P  P  V  E  I  G  P  I  L  A  V  D  P  L         p.17860

   | 280     .         .         .         .         .         .    g.230148
 G | GTCCTCCAACATCTCCAGAGAGGCTCACATACACTGAAAGGACAAAGTCCACTATCACA    c.53640
 G |   P  P  T  S  P  E  R  L  T  Y  T  E  R  T  K  S  T  I  T      p.17880

          .         .         .         .         .         .       g.230208
 CTTGACTGGAAAGAGCCCCGCAGTAATGGTGGCAGTCCCATCCAAGGATATATCATTGAA       c.53700
 L  D  W  K  E  P  R  S  N  G  G  S  P  I  Q  G  Y  I  I  E         p.17900

          .         .         .         .         .         .       g.230268
 AAACGGCGTCATGACAAACCTGACTTTGAAAGAGTTAACAAGCGACTCTGCCCAACCACA       c.53760
 K  R  R  H  D  K  P  D  F  E  R  V  N  K  R  L  C  P  T  T         p.17920

          .         .         .         .         .         .       g.230328
 TCTTTTCTGGTTGAAAATCTTGATGAACACCAAATGTATGAGTTCCGTGTCAAAGCTGTC       c.53820
 S  F  L  V  E  N  L  D  E  H  Q  M  Y  E  F  R  V  K  A  V         p.17940

          .         .         .         .         .         .       g.230388
 AATGAAATTGGTGAAAGTGAACCATCCCTACCTCTTAATGTAGTCATACAAGATGATGAA       c.53880
 N  E  I  G  E  S  E  P  S  L  P  L  N  V  V  I  Q  D  D  E         p.17960

   | 281     .         .         .         .         .         .    g.230566
 G | TGCCTCCAACTATTAAGTTGCGTCTGAGTGTTCGAGGAGACACTATCAAAGTTAAGGCA    c.53940
 V |   P  P  T  I  K  L  R  L  S  V  R  G  D  T  I  K  V  K  A      p.17980

          .         .         .         .         .         .       g.230626
 GGAGAGCCTGTCCACATCCCTGCAGATGTGACAGGCCTTCCAATGCCTAAGATTGAATGG       c.54000
 G  E  P  V  H  I  P  A  D  V  T  G  L  P  M  P  K  I  E  W         p.18000

          .         .         .         .         .         .       g.230686
 TCCAAAAATGAAACTGTAATTGAAAAACCCACTGATGCACTTCAGATAACCAAGGAAGAG       c.54060
 S  K  N  E  T  V  I  E  K  P  T  D  A  L  Q  I  T  K  E  E         p.18020

          .         .         .         .         .         .       g.230746
 GTATCCCGAAGTGAGGCAAAAACTGAGCTTAGCATTCCCAAAGCGGTCCGGGAGGACAAA       c.54120
 V  S  R  S  E  A  K  T  E  L  S  I  P  K  A  V  R  E  D  K         p.18040

          .         .         .         .         .         .       g.230806
 GGCACTTACACAGTTACTGCTTCCAATCGCCTTGGCTCAGTGTTCCGAAATGTTCACGTT       c.54180
 G  T  Y  T  V  T  A  S  N  R  L  G  S  V  F  R  N  V  H  V         p.18060

          . | 282      .         .         .         .         .    g.230954
 GAAGTATATG | ACCGCCCATCCCCACCAAGAAATCTTGCTGTTACTGACATTAAAGCTGAA    c.54240
 E  V  Y  D |   R  P  S  P  P  R  N  L  A  V  T  D  I  K  A  E      p.18080

          .         .         .         .         .         .       g.231014
 TCTTGCTACTTGACATGGGATGCCCCTCTTGATAATGGTGGCAGTGAAATCACCCATTAT       c.54300
 S  C  Y  L  T  W  D  A  P  L  D  N  G  G  S  E  I  T  H  Y         p.18100

          .         .         .         .         .         .       g.231074
 GTTATTGACAAACGTGATGCAAGTAGGAAGAAAGCAGAATGGGAGGAAGTCACCAACACT       c.54360
 V  I  D  K  R  D  A  S  R  K  K  A  E  W  E  E  V  T  N  T         p.18120

          .         .  | 283     .         .         .         .    g.231536
 GCTGTAGAGAAAAGATATGGG | ATCTGGAAACTTATCCCCAATGGTCAGTATGAGTTCCGA    c.54420
 A  V  E  K  R  Y  G   | I  W  K  L  I  P  N  G  Q  Y  E  F  R      p.18140

          .         .         .         .         .         .       g.231596
 GTCAGGGCAGTGAATAAATATGGAATCAGTGATGAGTGCAAATCAGATAAAGTAGTCATT       c.54480
 V  R  A  V  N  K  Y  G  I  S  D  E  C  K  S  D  K  V  V  I         p.18160

          .         .         .         .         .         .       g.231656
 CAAGATCCTTATCGCCTTCCTGGACCTCCAGGAAAACCAAAAGTTTTGGCACGCACCAAA       c.54540
 Q  D  P  Y  R  L  P  G  P  P  G  K  P  K  V  L  A  R  T  K         p.18180

          .         .         .         .         .         .       g.231716
 GGATCAATGCTAGTGAGCTGGACTCCTCCTTTGGACAATGGTGGCTCTCCAATTACTGGC       c.54600
 G  S  M  L  V  S  W  T  P  P  L  D  N  G  G  S  P  I  T  G         p.18200

          .         .         .         .         .         .       g.231776
 TACTGGCTGGAGAAAAGAGAAGAGGGAAGTCCTTATTGGTCACGTGTTAGCCGAGCACCA       c.54660
 Y  W  L  E  K  R  E  E  G  S  P  Y  W  S  R  V  S  R  A  P         p.18220

          .         .         .         .         .         .       g.231836
 ATAACCAAAGTGGGATTGAAAGGCGTGGAATTTAATGTTCCTCGTTTGCTTGAAGGCGTT       c.54720
 I  T  K  V  G  L  K  G  V  E  F  N  V  P  R  L  L  E  G  V         p.18240

          .         .         .         .         .         .       g.231896
 AAATACCAGTTCAGAGCCATGGCAATAAATGCTGCAGGAATTGGTCCTCCCAGTGAACCA       c.54780
 K  Y  Q  F  R  A  M  A  I  N  A  A  G  I  G  P  P  S  E  P         p.18260

          .         .         .  | 284     .         .         .    g.233241
 TCAGATCCAGAGGTTGCAGGAGATCCCATAT | TTCCACCGGGGCCACCTTCTTGCCCAGAA    c.54840
 S  D  P  E  V  A  G  D  P  I  F |   P  P  G  P  P  S  C  P  E      p.18280

          .         .         .         .         .         .       g.233301
 GTTAAAGATAAAACGAAGTCAAGCATCTCACTAGGATGGAAACCTCCAGCCAAAGATGGT       c.54900
 V  K  D  K  T  K  S  S  I  S  L  G  W  K  P  P  A  K  D  G         p.18300

          .         .         .         .         .         .       g.233361
 GGCAGCCCAATCAAAGGATACATTGTAGAAATGCAAGAAGAAGGTACTACTGACTGGAAA       c.54960
 G  S  P  I  K  G  Y  I  V  E  M  Q  E  E  G  T  T  D  W  K         p.18320

          .         .         .         .         .         .       g.233421
 AGAGTAAATGAACCAGACAAACTTATAACTACCTGTGAATGTGTGGTGCCTAATCTGAAA       c.55020
 R  V  N  E  P  D  K  L  I  T  T  C  E  C  V  V  P  N  L  K         p.18340

          .         .         .         .         .         .       g.233481
 GAGCTCAGGAAGTACAGATTCAGAGTGAAAGCTGTCAATGAAGCTGGTGAATCTGAACCA       c.55080
 E  L  R  K  Y  R  F  R  V  K  A  V  N  E  A  G  E  S  E  P         p.18360

          .         .         .         . | 285      .         .    g.233672
 AGTGATACAACTGGGGAGATCCCTGCCACTGATATTCAAG | AGGAACCAGAAGTTTTCATT    c.55140
 S  D  T  T  G  E  I  P  A  T  D  I  Q  E |   E  P  E  V  F  I      p.18380

          .         .         .         .         .         .       g.233732
 GACATTGGAGCACAGGACTGTCTGGTTTGTAAAGCTGGCTCACAGATTAGGATTCCTGCT       c.55200
 D  I  G  A  Q  D  C  L  V  C  K  A  G  S  Q  I  R  I  P  A         p.18400

          .         .         .         .         .         .       g.233792
 GTCATCAAGGGACGCCCAACACCAAAATCATCTTGGGAATTTGATGGAAAGGCAAAGAAA       c.55260
 V  I  K  G  R  P  T  P  K  S  S  W  E  F  D  G  K  A  K  K         p.18420

           | 286       .         .         .   | 287    .         . g.234033
 GCAATGAAG | GATGGAGTTCATGACATACCCGAAGATGCACAG | CTGGAGACTGCTGAAAAC c.55320
 A  M  K   | D  G  V  H  D  I  P  E  D  A  Q   | L  E  T  A  E  N   p.18440

          .         .         .         .         .         .       g.234093
 TCCTCAGTAATTATTATTCCGGAGTGTAAACGATCTCATACAGGCAAATACAGCATCACA       c.55380
 S  S  V  I  I  I  P  E  C  K  R  S  H  T  G  K  Y  S  I  T         p.18460

          .         .         .         .         .   | 288    .    g.234246
 GCCAAGAATAAAGCAGGACAAAAGACTGCAAATTGCAGAGTTAAAGTCATGG | ATGTACCA    c.55440
 A  K  N  K  A  G  Q  K  T  A  N  C  R  V  K  V  M  D |   V  P      p.18480

          .         .         .         .         .         .       g.234306
 GGCCCACCCAAAGATCTGAAAGTCAGTGATATCACAAGGGGTAGTTGCAGACTTTCATGG       c.55500
 G  P  P  K  D  L  K  V  S  D  I  T  R  G  S  C  R  L  S  W         p.18500

          .         .         .         .         .         .       g.234366
 AAGATGCCAGACGACGATGGAGGAGACAGGATCAAAGGCTATGTTATTGAGAAGAGGACT       c.55560
 K  M  P  D  D  D  G  G  D  R  I  K  G  Y  V  I  E  K  R  T         p.18520

          .         .         .         .         .         .       g.234426
 ATTGATGGAAAAGCCTGGACCAAAGTCAATCCAGACTGTGGAAGCACCACATTTGTAGTG       c.55620
 I  D  G  K  A  W  T  K  V  N  P  D  C  G  S  T  T  F  V  V         p.18540

          .         .         .         .         .         .       g.234486
 CCTGATCTCCTCTCTGAACAGCAATATTTCTTCCGTGTGCGAGCAGAAAACCGTTTTGGT       c.55680
 P  D  L  L  S  E  Q  Q  Y  F  F  R  V  R  A  E  N  R  F  G         p.18560

          .         .         .         .         .   | 289    .    g.234639
 ATTGGCCCACCTGTGGAAACCATTCAGAGGACCACTGCCAGAGATCCGATAT | ATCCTCCT    c.55740
 I  G  P  P  V  E  T  I  Q  R  T  T  A  R  D  P  I  Y |   P  P      p.18580

          .         .         .         .         .         .       g.234699
 GATCCTCCTATTAAACTCAAGATTGGCCTCATCACAAAGAACACAGTGCATCTGTCATGG       c.55800
 D  P  P  I  K  L  K  I  G  L  I  T  K  N  T  V  H  L  S  W         p.18600

          .         .         .         .         .         .       g.234759
 AAACCCCCGAAGAATGATGGGGGCTCCCCTGTTACCCACTATATTGTTGAGTGCCTTGCA       c.55860
 K  P  P  K  N  D  G  G  S  P  V  T  H  Y  I  V  E  C  L  A         p.18620

          .         .         .         .         .         .       g.234819
 TGGGACCCTACTGGGACAAAGAAAGAAGCCTGGAGGCAGTGCAATAAGCGTGATGTGGAA       c.55920
 W  D  P  T  G  T  K  K  E  A  W  R  Q  C  N  K  R  D  V  E         p.18640

          .         .         .         .         .         .       g.234879
 GAACTGCAATTTACTGTTGAAGACCTAGTAGAGGGTGGGGAATATGAATTCCGAGTCAAA       c.55980
 E  L  Q  F  T  V  E  D  L  V  E  G  G  E  Y  E  F  R  V  K         p.18660

          .         .         .         .         .         .       g.234939
 GCTGTCAATGCTGCAGGAGTCAGCAAGCCTTCAGCCACTGTTGGCCCTGTGACTGTCAAA       c.56040
 A  V  N  A  A  G  V  S  K  P  S  A  T  V  G  P  V  T  V  K         p.18680

          . | 290      .         .         .         .         .    g.236002
 GACCAGACAT | GCCCACCATCAATTGATCTAAAAGAATTCATGGAGGTTGAAGAAGGAACC    c.56100
 D  Q  T  C |   P  P  S  I  D  L  K  E  F  M  E  V  E  E  G  T      p.18700

          .         .         .         .         .         .       g.236062
 AATGTTAACATTGTGGCCAAAATTAAAGGTGTGCCATTCCCGACACTAACCTGGTTTAAA       c.56160
 N  V  N  I  V  A  K  I  K  G  V  P  F  P  T  L  T  W  F  K         p.18720

          .         .         .         .         .         .       g.236122
 GCTCCTCCAAAGAAGCCTGATAACAAAGAACCTGTTCTCTATGACACCCATGTCAACAAA       c.56220
 A  P  P  K  K  P  D  N  K  E  P  V  L  Y  D  T  H  V  N  K         p.18740

          .         .         .         .         .         .       g.236182
 CTGGTGGTAGATGATACTTGCACTTTAGTTATTCCGCAGTCTCGCAGGAGTGACACTGGC       c.56280
 L  V  V  D  D  T  C  T  L  V  I  P  Q  S  R  R  S  D  T  G         p.18760

          .         .         .         .         .         .       g.236242
 TTATATACCATCACAGCTGTAAATAATCTGGGAACAGCATCAAAGGAGATGAGACTGAAT       c.56340
 L  Y  T  I  T  A  V  N  N  L  G  T  A  S  K  E  M  R  L  N         p.18780

         | 291         .         .         .         .         .    g.236410
 GTCCTGG | GTCGTCCTGGCCCTCCAGTGGGACCCATAAAATTTGAATCTGTTTCAGCAGAT    c.56400
 V  L  G |   R  P  G  P  P  V  G  P  I  K  F  E  S  V  S  A  D      p.18800

          .         .         .         .         .         .       g.236470
 CAAATGACACTATCTTGGTTTCCACCTAAAGATGATGGTGGGTCTAAGATTACAAACTAT       c.56460
 Q  M  T  L  S  W  F  P  P  K  D  D  G  G  S  K  I  T  N  Y         p.18820

          .         .         .         .         .         .       g.236530
 GTAATTGAGAAAAGAGAAGCTAACAGGAAGACATGGGTCCATGTCTCCAGTGAACCTAAG       c.56520
 V  I  E  K  R  E  A  N  R  K  T  W  V  H  V  S  S  E  P  K         p.18840

          .         .         .         .         .         .       g.236590
 GAGTGCACGTACACGATTCCCAAATTGCTAGAAGGCCATGAATATGTATTCCGAATCATG       c.56580
 E  C  T  Y  T  I  P  K  L  L  E  G  H  E  Y  V  F  R  I  M         p.18860

          .         .         .         .         .         .       g.236650
 GCCCAGAATAAATATGGCATTGGAGAACCTCTTGACAGTGAACCTGAAACAGCAAGAAAC       c.56640
 A  Q  N  K  Y  G  I  G  E  P  L  D  S  E  P  E  T  A  R  N         p.18880

         | 292         .         .         .         .         .    g.236793
 CTCTTCT | CTGTCCCTGGAGCACCAGATAAACCAACAGTTAGCAGCGTGACTCGTAACTCC    c.56700
 L  F  S |   V  P  G  A  P  D  K  P  T  V  S  S  V  T  R  N  S      p.18900

          .         .         .         .         .         .       g.236853
 ATGACTGTCAACTGGGAAGAGCCAGAATATGATGGAGGCTCTCCTGTGACAGGGTACTGG       c.56760
 M  T  V  N  W  E  E  P  E  Y  D  G  G  S  P  V  T  G  Y  W         p.18920

          .         .         .         .         .         .       g.236913
 CTGGAAATGAAAGACACCACTTCAAAGAGATGGAAGAGAGTTAACCGAGATCCTATCAAA       c.56820
 L  E  M  K  D  T  T  S  K  R  W  K  R  V  N  R  D  P  I  K         p.18940

          .         .         .         .         .         .       g.236973
 GCCATGACTTTGGGTGTTTCTTATAAAGTGACTGGTCTTATTGAAGGTTCCGACTATCAA       c.56880
 A  M  T  L  G  V  S  Y  K  V  T  G  L  I  E  G  S  D  Y  Q         p.18960

          .         .         .         .         .         .       g.237033
 TTCCGGGTATATGCAATCAATGCTGCTGGCGTGGGTCCAGCAAGTCTGCCATCAGACCCA       c.56940
 F  R  V  Y  A  I  N  A  A  G  V  G  P  A  S  L  P  S  D  P         p.18980

          .         .   | 293    .         .         .         .    g.237186
 GCGACTGCTAGAGATCCAATTG | CCCCTCCTGGTCCTCCATTTCCCAAAGTGACAGATTGG    c.57000
 A  T  A  R  D  P  I  A |   P  P  G  P  P  F  P  K  V  T  D  W      p.19000

          .         .         .         .         .         .       g.237246
 ACTAAATCATCTGCAGATCTGGAGTGGTCTCCCCCACTAAAAGATGGTGGATCCAAAGTA       c.57060
 T  K  S  S  A  D  L  E  W  S  P  P  L  K  D  G  G  S  K  V         p.19020

          .         .         .         .         .  | 294     .    g.237753
 ACTGGATACATCGTTGAATATAAAGAAGAAGGAAAAGAAGAATGGGAAAAG | GGTAAAGAT    c.57120
 T  G  Y  I  V  E  Y  K  E  E  G  K  E  E  W  E  K   | G  K  D      p.19040

          .         .         .         .         .         .       g.237813
 AAAGAAGTGAGAGGAACAAAGCTTGTTGTGACAGGATTAAAGGAAGGAGCATTCTACAAA       c.57180
 K  E  V  R  G  T  K  L  V  V  T  G  L  K  E  G  A  F  Y  K         p.19060

          .         .         .         .         .         .       g.237873
 TTTAGAGTTAGAGCAGTCAACATTGCTGGCATTGGAGAACCTGGAGAGGTCACAGATGTC       c.57240
 F  R  V  R  A  V  N  I  A  G  I  G  E  P  G  E  V  T  D  V         p.19080

          .         .   | 295    .         .         .         .    g.238021
 ATTGAAATGAAGGACAGACTTG | TTTCACCTGACCTTCAGCTAGATGCCAGTGTCAGAGAT    c.57300
 I  E  M  K  D  R  L  V |   S  P  D  L  Q  L  D  A  S  V  R  D      p.19100

          .         .         .         .         .         .       g.238081
 AGAATTGTTGTCCATGCTGGAGGGGTGATCCGAATCATTGCCTATGTGTCTGGAAAGCCT       c.57360
 R  I  V  V  H  A  G  G  V  I  R  I  I  A  Y  V  S  G  K  P         p.19120

          .         .         .         .         .         .       g.238141
 CCTCCAACCGTCACCTGGAACATGAATGAAAGAACCTTACCTCAAGAAGCCACCATTGAG       c.57420
 P  P  T  V  T  W  N  M  N  E  R  T  L  P  Q  E  A  T  I  E         p.19140

          .         .         .         .         .         .       g.238201
 ACCACAGCCATTAGCTCATCCATGGTCATCAAGAACTGCCAGAGGAGCCATCAAGGCGTC       c.57480
 T  T  A  I  S  S  S  M  V  I  K  N  C  Q  R  S  H  Q  G  V         p.19160

          .         .         .         .         .         .       g.238261
 TATTCTCTTCTTGCCAAAAATGAAGCCGGAGAAAGAAAGAAGACAATTATTGTTGATGTA       c.57540
 Y  S  L  L  A  K  N  E  A  G  E  R  K  K  T  I  I  V  D  V         p.19180

      | 296  .         .         .         .         .         .    g.240049
 TTAG | ATGTTCCAGGTCCCGTTGGAACACCATTCCTAGCTCACAACCTAACCAATGAGTCC    c.57600
 L  D |   V  P  G  P  V  G  T  P  F  L  A  H  N  L  T  N  E  S      p.19200

          .         .         .         .         .         .       g.240109
 TGCAAACTGACATGGTTTTCTCCAGAAGATGATGGAGGCTCTCCAATCACCAATTATGTC       c.57660
 C  K  L  T  W  F  S  P  E  D  D  G  G  S  P  I  T  N  Y  V         p.19220

          .         .         .         .         .         .       g.240169
 ATTGAAAAGCGTGAATCTGACCGCAGAGCATGGACCCCAGTGACATATACAGTTACCCGA       c.57720
 I  E  K  R  E  S  D  R  R  A  W  T  P  V  T  Y  T  V  T  R         p.19240

          .         .         .         .         .         .       g.240229
 CAAAATGCTACTGTCCAGGGTCTCATTCAAGGAAAAGCCTACTTTTTCCGAATTGCGGCT       c.57780
 Q  N  A  T  V  Q  G  L  I  Q  G  K  A  Y  F  F  R  I  A  A         p.19260

          .         .         .         .         .         .       g.240289
 GAAAATAGTATTGGCATGGGTCCATTTGTTGAGACATCAGAGGCACTTGTTATCAGAGAG       c.57840
 E  N  S  I  G  M  G  P  F  V  E  T  S  E  A  L  V  I  R  E         p.19280

         | 297         .         .         .         .         .    g.241209
 CCAATAA | CTGTACCAGAGCGTCCTGAAGACCTGGAAGTCAAAGAAGTTACTAAAAATACT    c.57900
 P  I  T |   V  P  E  R  P  E  D  L  E  V  K  E  V  T  K  N  T      p.19300

          .         .         .         .         .         .       g.241269
 GTAACTTTGACTTGGAATCCTCCTAAGTATGATGGTGGGTCAGAAATTATTAACTATGTC       c.57960
 V  T  L  T  W  N  P  P  K  Y  D  G  G  S  E  I  I  N  Y  V         p.19320

          .         .         .         .         .         .       g.241329
 CTAGAAAGTCGGCTCATTGGGACTGAGAAGTTCCACAAAGTTACAAATGACAACTTGCTT       c.58020
 L  E  S  R  L  I  G  T  E  K  F  H  K  V  T  N  D  N  L  L         p.19340

          .         .         .         .         .         .       g.241389
 AGCAGAAAATACACTGTTAAAGGCTTAAAAGAAGGTGATACCTATGAGTACCGTGTCAGT       c.58080
 S  R  K  Y  T  V  K  G  L  K  E  G  D  T  Y  E  Y  R  V  S         p.19360

          .         .         .         .         .         .       g.241449
 GCTGTCAACATTGTTGGACAAGGCAAACCATCATTTTGCACCAAACCAATTACTTGCAAG       c.58140
 A  V  N  I  V  G  Q  G  K  P  S  F  C  T  K  P  I  T  C  K         p.19380

          . | 298      .         .         .         .         .    g.241610
 GATGAGCTGG | CACCCCCAACGCTTCACCTCGACTTCAGAGATAAGCTCACGATTCGAGTT    c.58200
 D  E  L  A |   P  P  T  L  H  L  D  F  R  D  K  L  T  I  R  V      p.19400

          .         .         .         .         .         .       g.241670
 GGTGAAGCTTTTGCCCTCACTGGCCGTTACTCAGGCAAACCAAAGCCTAAGGTTTCCTGG       c.58260
 G  E  A  F  A  L  T  G  R  Y  S  G  K  P  K  P  K  V  S  W         p.19420

          .         .         .         .         .         .       g.241730
 TTCAAAGATGAAGCTGATGTGCTGGAAGATGATCGCACTCATATAAAGACTACACCAGCA       c.58320
 F  K  D  E  A  D  V  L  E  D  D  R  T  H  I  K  T  T  P  A         p.19440

          .         .         .         .         .         .       g.241790
 ACACTTGCTTTAGAGAAGATCAAGGCCAAACGTTCAGATTCCGGCAAATACTGTGTGGTT       c.58380
 T  L  A  L  E  K  I  K  A  K  R  S  D  S  G  K  Y  C  V  V         p.19460

          .         .         .         .         .   | 299    .    g.241943
 GTGGAGAACAGTACAGGCTCTAGGAAAGGTTTCTGTCAAGTTAATGTTGTTG | ACCGTCCT    c.58440
 V  E  N  S  T  G  S  R  K  G  F  C  Q  V  N  V  V  D |   R  P      p.19480

          .         .         .         .         .         .       g.242003
 GGACCACCAGTAGGACCAGTTAGTTTTGATGAGGTGACCAAAGATTACATGGTTATCTCT       c.58500
 G  P  P  V  G  P  V  S  F  D  E  V  T  K  D  Y  M  V  I  S         p.19500

          .         .         .         .         .         .       g.242063
 TGGAAGCCTCCTTTAGATGATGGAGGCAGTAAAATCACCAATTATATTATTGAGAAGAAG       c.58560
 W  K  P  P  L  D  D  G  G  S  K  I  T  N  Y  I  I  E  K  K         p.19520

          .         .         .         .         .         .       g.242123
 GAAGTGGGTAAAGACGTCTGGATGCCAGTGACATCTGCAAGTGCTAAAACAACATGCAAA       c.58620
 E  V  G  K  D  V  W  M  P  V  T  S  A  S  A  K  T  T  C  K         p.19540

          .         .         .         .         .         .       g.242183
 GTTTCTAAACTACTTGAAGGAAAAGATTATATTTTCCGGATACATGCTGAAAATCTGTAT       c.58680
 V  S  K  L  L  E  G  K  D  Y  I  F  R  I  H  A  E  N  L  Y         p.19560

          .         .         .         .         .   | 300    .    g.242335
 GGAATAAGTGATCCTCTGGTGTCTGATTCAATGAAAGCCAAAGATCGTTTCA | GGGTTCCT    c.58740
 G  I  S  D  P  L  V  S  D  S  M  K  A  K  D  R  F  R |   V  P      p.19580

          .         .         .         .         .         .       g.242395
 GATGCACCTGATCAGCCAATTGTTACAGAAGTTACCAAAGACTCTGCATTAGTAACCTGG       c.58800
 D  A  P  D  Q  P  I  V  T  E  V  T  K  D  S  A  L  V  T  W         p.19600

          .         .         .         .         .         .       g.242455
 AATAAGCCACATGATGGAGGAAAACCCATCACAAACTACATCCTGGAAAAGAGAGAAACT       c.58860
 N  K  P  H  D  G  G  K  P  I  T  N  Y  I  L  E  K  R  E  T         p.19620

          .         .         .         .         .         .       g.242515
 ATGTCTAAACGATGGGCTAGAGTTACCAAAGATCCTATTCATCCATACACTAAATTTAGG       c.58920
 M  S  K  R  W  A  R  V  T  K  D  P  I  H  P  Y  T  K  F  R         p.19640

          .         .         .         .         .         .       g.242575
 GTTCCTGATCTTCTAGAAGGATGTCAGTATGAATTCCGGGTTTCTGCAGAAAATGAAATT       c.58980
 V  P  D  L  L  E  G  C  Q  Y  E  F  R  V  S  A  E  N  E  I         p.19660

          .         .         .         .         .      | 301 .    g.242724
 GGTATTGGAGATCCAAGCCCACCATCCAAACCAGTCTTTGCTAAAGATCCAATTG | CTAAA    c.59040
 G  I  G  D  P  S  P  P  S  K  P  V  F  A  K  D  P  I  A |   K      p.19680

          .         .         .         .         .         .       g.242784
 CCAAGTCCACCTGTTAATCCTGAAGCAATAGATACAACATGCAATTCAGTCGATCTAACT       c.59100
 P  S  P  P  V  N  P  E  A  I  D  T  T  C  N  S  V  D  L  T         p.19700

          .         .         .         .         .         .       g.242844
 TGGCAGCCACCACGTCATGATGGTGGGAGCAAGATTCTGGGTTATATTGTTGAGTACCAG       c.59160
 W  Q  P  P  R  H  D  G  G  S  K  I  L  G  Y  I  V  E  Y  Q         p.19720

          .         .         .         .         .         .       g.242904
 AAAGTTGGAGATGAAGAGTGGAGAAGAGCCAATCACACCCCTGAGTCATGTCCTGAAACT       c.59220
 K  V  G  D  E  E  W  R  R  A  N  H  T  P  E  S  C  P  E  T         p.19740

          .         .         .         .         .         .       g.242964
 AAATATAAAGTCACCGGTCTTCGGGACGGTCAAACCTATAAGTTTAGAGTGTTAGCAGTC       c.59280
 K  Y  K  V  T  G  L  R  D  G  Q  T  Y  K  F  R  V  L  A  V         p.19760

          .         .         .         .         .         .       g.243024
 AATGCAGCTGGTGAATCAGATCCAGCTCATGTTCCGGAGCCAGTCCTAGTAAAAGACAGG       c.59340
 N  A  A  G  E  S  D  P  A  H  V  P  E  P  V  L  V  K  D  R         p.19780

      | 302  .         .         .         .         .         .    g.243198
 CTTG | AACCCCCTGAGTTGATTCTTGATGCCAACATGGCAAGAGAACAACACATTAAAGTT    c.59400
 L  E |   P  P  E  L  I  L  D  A  N  M  A  R  E  Q  H  I  K  V      p.19800

          .         .         .         .         .         .       g.243258
 GGTGATACTCTAAGACTTAGTGCCATCATCAAAGGAGTGCCATTCCCAAAAGTAACTTGG       c.59460
 G  D  T  L  R  L  S  A  I  I  K  G  V  P  F  P  K  V  T  W         p.19820

          .         .         .         .         .         .       g.243318
 AAAAAAGAAGACAGAGATGCTCCAACTAAAGCAAGAATTGATGTGACTCCAGTTGGTAGC       c.59520
 K  K  E  D  R  D  A  P  T  K  A  R  I  D  V  T  P  V  G  S         p.19840

          .         .         .         .         .         .       g.243378
 AAGCTTGAAATTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTTAACAGTGGAG       c.59580
 K  L  E  I  R  N  A  A  H  E  D  G  G  I  Y  S  L  T  V  E         p.19860

          .         .         .         .       | 303.         .    g.243539
 AATCCAGCTGGTTCAAAAACTGTCTCAGTAAAAGTACTTGTATTAG | ATAAACCTGGGCCA    c.59640
 N  P  A  G  S  K  T  V  S  V  K  V  L  V  L  D |   K  P  G  P      p.19880

          .         .         .         .         .         .       g.243599
 CCTAGAGATCTGGAAGTCAGTGAAATTAGGAAAGATTCATGTTACCTTACTTGGAAAGAA       c.59700
 P  R  D  L  E  V  S  E  I  R  K  D  S  C  Y  L  T  W  K  E         p.19900

          .         .         .         .         .         .       g.243659
 CCACTGGATGATGGTGGTTCTGTTATTACCAATTATGTGGTTGAGAGGAGAGATGTTGCC       c.59760
 P  L  D  D  G  G  S  V  I  T  N  Y  V  V  E  R  R  D  V  A         p.19920

          .         .         .         .         .         .       g.243719
 AGCGCCCAGTGGTCACCTCTCTCAGCTACATCAAAGAAAAAGAGTCACTTCGCTAAGCAT       c.59820
 S  A  Q  W  S  P  L  S  A  T  S  K  K  K  S  H  F  A  K  H         p.19940

          .         .         .         .         .         .       g.243779
 CTGAATGAAGGCAACCAGTACCTCTTCCGAGTAGCTGCGGAGAACCAGTATGGACGTGGT       c.59880
 L  N  E  G  N  Q  Y  L  F  R  V  A  A  E  N  Q  Y  G  R  G         p.19960

          .         .         .         .       | 304.         .    g.243924
 CCTTTTGTTGAAACACCAAAACCAATCAAGGCTTTGGATCCTCTCC | ATCCCCCAGGGCCA    c.59940
 P  F  V  E  T  P  K  P  I  K  A  L  D  P  L  H |   P  P  G  P      p.19980

          .         .         .         .         .         .       g.243984
 CCCAAGGACCTGCACCATGTAGATGTTGACAAGACTGAAGTCTCCCTAGTCTGGAATAAG       c.60000
 P  K  D  L  H  H  V  D  V  D  K  T  E  V  S  L  V  W  N  K         p.20000

          .         .         .         .         .         .       g.244044
 CCGGATCGTGATGGTGGTTCTCCAATCACTGGATATTTGGTAGAATATCAAGAAGAAGGC       c.60060
 P  D  R  D  G  G  S  P  I  T  G  Y  L  V  E  Y  Q  E  E  G         p.20020

          .         .         .         .         .         .       g.244104
 ACCCAGGACTGGATTAAATTTAAGACTGTGACAAACTTAGAGTGTGTGGTTACTGGACTA       c.60120
 T  Q  D  W  I  K  F  K  T  V  T  N  L  E  C  V  V  T  G  L         p.20040

          .         .         .         .         .         .       g.244164
 CAACAAGGAAAGACCTATAGATTCCGTGTAAAAGCTGAAAACATTGTGGGTCTTGGTCTC       c.60180
 Q  Q  G  K  T  Y  R  F  R  V  K  A  E  N  I  V  G  L  G  L         p.20060

          .         .         .         . | 305      .         .    g.244318
 CCTGACACAACTATCCCGATAGAATGTCAAGAAAAACTAG | TGCCTCCATCCGTGGAGCTA    c.60240
 P  D  T  T  I  P  I  E  C  Q  E  K  L  V |   P  P  S  V  E  L      p.20080

          .         .         .         .         .         .       g.244378
 GATGTGAAATTAATTGAAGGTCTTGTGGTAAAGGCTGGAACCACAGTCAGATTCCCTGCT       c.60300
 D  V  K  L  I  E  G  L  V  V  K  A  G  T  T  V  R  F  P  A         p.20100

          .         .         .         .         .         .       g.244438
 ATTATAAGAGGTGTGCCTGTTCCTACTGCAAAGTGGACAACCGATGGGAGTGAGATTAAA       c.60360
 I  I  R  G  V  P  V  P  T  A  K  W  T  T  D  G  S  E  I  K         p.20120

          .         .         .         .         .         .       g.244498
 ACCGATGAGCACTACACAGTTGAAACAGACAACTTCTCATCAGTACTTACCATTAAGAAC       c.60420
 T  D  E  H  Y  T  V  E  T  D  N  F  S  S  V  L  T  I  K  N         p.20140

          .         .         .         .         .         .       g.244558
 TGCTTAAGGAGAGACACTGGGGAATATCAAATCACAGTTTCCAATGCAGCCGGTAGCAAA       c.60480
 C  L  R  R  D  T  G  E  Y  Q  I  T  V  S  N  A  A  G  S  K         p.20160

          .         .         .         .         .         .       g.244618
 ACAGTAGCCGTACATCTTACTGTTCTTGATGTTCCTGGGCCACCAACAGGTCCTATTAAT       c.60540
 T  V  A  V  H  L  T  V  L  D  V  P  G  P  P  T  G  P  I  N         p.20180

          .         .         .         .         .         .       g.244678
 ATTCTGGATGTTACTCCTGAACACATGACTATCTCATGGCAGCCACCTAAGGATGATGGA       c.60600
 I  L  D  V  T  P  E  H  M  T  I  S  W  Q  P  P  K  D  D  G         p.20200

          .         .         .         .         .         .       g.244738
 GGAAGCCCTGTGATAAATTATATTGTTGAGAAACAAGATACAAGGAAAGACACGTGGGGT       c.60660
 G  S  P  V  I  N  Y  I  V  E  K  Q  D  T  R  K  D  T  W  G         p.20220

          .         .         .         .         .         .       g.244798
 GTTGTCTCTTCCGGAAGCAGTAAGACAAAGCTGAAAATCCCACATCTGCAGAAGGGCTGT       c.60720
 V  V  S  S  G  S  S  K  T  K  L  K  I  P  H  L  Q  K  G  C         p.20240

          .         .         .         .         .         .       g.244858
 GAATATGTTTTCCGAGTTAGAGCAGAGAATAAGATAGGTGTTGGTCCTCCCCTTGACTCC       c.60780
 E  Y  V  F  R  V  R  A  E  N  K  I  G  V  G  P  P  L  D  S         p.20260

          .         .         .         .         .         .       g.244918
 ACACCTACTGTTGCTAAGCATAAATTTAGTCCTCCGTCTCCTCCTGGTAAACCAGTGGTT       c.60840
 T  P  T  V  A  K  H  K  F  S  P  P  S  P  P  G  K  P  V  V         p.20280

          .         .         .         .         .         .       g.244978
 ACTGACATTACTGAAAATGCAGCAACAGTGTCTTGGACCCTGCCAAAATCTGATGGTGGC       c.60900
 T  D  I  T  E  N  A  A  T  V  S  W  T  L  P  K  S  D  G  G         p.20300

          .         .         .         .         .         .       g.245038
 AGTCCAATAACTGGCTACTATATGGAACGTCGAGAAGTAACTGGCAAATGGGTGAGGGTC       c.60960
 S  P  I  T  G  Y  Y  M  E  R  R  E  V  T  G  K  W  V  R  V         p.20320

          .         .         .         .         .         .       g.245098
 AACAAAACACCTATCGCTGACCTGAAGTTCAGAGTGACTGGACTCTATGAAGGAAATACA       c.61020
 N  K  T  P  I  A  D  L  K  F  R  V  T  G  L  Y  E  G  N  T         p.20340

          .         .         .         .         .         .       g.245158
 TATGAGTTTAGAGTTTTTGCTGAAAATCTTGCAGGACTAAGCAAACCATCCCCAAGTTCT       c.61080
 Y  E  F  R  V  F  A  E  N  L  A  G  L  S  K  P  S  P  S  S         p.20360

          .         .         .         .         .         .       g.245218
 GATCCAATAAAAGCTTGCCGGCCCATCAAACCACCTGGACCACCTATTAATCCTAAACTG       c.61140
 D  P  I  K  A  C  R  P  I  K  P  P  G  P  P  I  N  P  K  L         p.20380

          .         .         .         .         .         .       g.245278
 AAAGACAAGAGCAGAGAAACAGCTGATTTGGTGTGGACAAAGCCTCTCAGTGATGGTGGT       c.61200
 K  D  K  S  R  E  T  A  D  L  V  W  T  K  P  L  S  D  G  G         p.20400

          .         .         .         .         .         .       g.245338
 AGCCCCATTCTAGGATATGTAGTGGAATGTCAGAAACCTGGCACAGCACAATGGAACAGG       c.61260
 S  P  I  L  G  Y  V  V  E  C  Q  K  P  G  T  A  Q  W  N  R         p.20420

          .         .         .         .         .         .       g.245398
 ATTAATAAAGATGAACTCATTAGGCAATGTGCCTTTAGGGTACCTGGACTAATTGAAGGA       c.61320
 I  N  K  D  E  L  I  R  Q  C  A  F  R  V  P  G  L  I  E  G         p.20440

          .         .         .         .         .         .       g.245458
 AATGAGTACAGATTCCGTATAAAGGCAGCTAATATTGTAGGAGAGGGTGAGCCAAGAGAA       c.61380
 N  E  Y  R  F  R  I  K  A  A  N  I  V  G  E  G  E  P  R  E         p.20460

          .         .         .         .         .         .       g.245518
 CTAGCAGAATCTGTGATTGCAAAAGATATCCTTCATCCTCCAGAAGTAGAACTTGATGTT       c.61440
 L  A  E  S  V  I  A  K  D  I  L  H  P  P  E  V  E  L  D  V         p.20480

          .         .         .         .         .         .       g.245578
 ACTTGTCGTGATGTTATTACCGTGAGAGTAGGCCAAACTATCCGCATTCTAGCTCGAGTC       c.61500
 T  C  R  D  V  I  T  V  R  V  G  Q  T  I  R  I  L  A  R  V         p.20500

          .         .         .         .         .         .       g.245638
 AAAGGCAGACCTGAACCAGACATAACTTGGACTAAGGAAGGCAAAGTATTGGTCCGAGAA       c.61560
 K  G  R  P  E  P  D  I  T  W  T  K  E  G  K  V  L  V  R  E         p.20520

          .         .         .         .         .         .       g.245698
 AAGAGGGTGGACCTTATTCAGGATCTACCTCGTGTTGAGTTACAAATTAAAGAAGCTGTT       c.61620
 K  R  V  D  L  I  Q  D  L  P  R  V  E  L  Q  I  K  E  A  V         p.20540

          .         .         .         .         .         .       g.245758
 AGAGCTGATCATGGCAAGTATATCATCTCAGCTAAGAACAGCAGTGGACATGCCCAAGGT       c.61680
 R  A  D  H  G  K  Y  I  I  S  A  K  N  S  S  G  H  A  Q  G         p.20560

          .         .         .         .         .         .       g.245818
 TCAGCCATCGTTAACGTCCTTGACAGACCTGGGCCTTGCCAGAATTTGAAGGTTACCAAT       c.61740
 S  A  I  V  N  V  L  D  R  P  G  P  C  Q  N  L  K  V  T  N         p.20580

          .         .         .         .         .         .       g.245878
 GTAACCAAAGAGAACTGTACAATTTCTTGGGAAAACCCACTAGATAATGGTGGCTCAGAA       c.61800
 V  T  K  E  N  C  T  I  S  W  E  N  P  L  D  N  G  G  S  E         p.20600

          .         .         .         .         .         .       g.245938
 ATAACAAACTTCATAGTAGAATATCGCAAACCAAACCAGAAAGGCTGGTCAATTGTTGCA       c.61860
 I  T  N  F  I  V  E  Y  R  K  P  N  Q  K  G  W  S  I  V  A         p.20620

          .         .         .         .         .         .       g.245998
 TCAGATGTCACTAAACGATTAATCAAGGCCAACCTTTTAGCCAACAATGAATACTATTTC       c.61920
 S  D  V  T  K  R  L  I  K  A  N  L  L  A  N  N  E  Y  Y  F         p.20640

          .         .         .         .         .         .       g.246058
 CGAGTTTGTGCAGAGAATAAAGTAGGTGTTGGGCCAACCATCGAAACAAAAACTCCCATT       c.61980
 R  V  C  A  E  N  K  V  G  V  G  P  T  I  E  T  K  T  P  I         p.20660

          .         .         .         .         .         .       g.246118
 CTGGCTATTAACCCTATTGACAGACCAGGTGAGCCTGAAAACCTTCACATTGCAGATAAA       c.62040
 L  A  I  N  P  I  D  R  P  G  E  P  E  N  L  H  I  A  D  K         p.20680

          .         .         .         .         .         .       g.246178
 GGAAAGACATTTGTCTATCTAAAGTGGCGGAGGCCTGACTATGATGGTGGCAGTCCAAAT       c.62100
 G  K  T  F  V  Y  L  K  W  R  R  P  D  Y  D  G  G  S  P  N         p.20700

          .         .         .         .         .         .       g.246238
 CTGTCATATCATGTTGAGAGAAGGCTTAAGGGCTCCGATGACTGGGAAAGAGTGCATAAA       c.62160
 L  S  Y  H  V  E  R  R  L  K  G  S  D  D  W  E  R  V  H  K         p.20720

          .         .         .         .         .         .       g.246298
 GGAAGCATTAAAGAAACTCACTACATGGTTGACAGATGTGTTGAAAACCAGATTTATGAG       c.62220
 G  S  I  K  E  T  H  Y  M  V  D  R  C  V  E  N  Q  I  Y  E         p.20740

          .         .         .         .         .         .       g.246358
 TTCAGAGTGCAAACAAAGAATGAAGGTGGGGAAAGTGACTGGGTGAAGACAGAGGAAGTT       c.62280
 F  R  V  Q  T  K  N  E  G  G  E  S  D  W  V  K  T  E  E  V         p.20760

          .         .         .         .         .         .       g.246418
 GTTGTGAAAGAAGACTTACAAAAACCAGTACTTGATCTGAAATTAAGTGGGGTCCTAACT       c.62340
 V  V  K  E  D  L  Q  K  P  V  L  D  L  K  L  S  G  V  L  T         p.20780

          .         .         .         .         .         .       g.246478
 GTCAAAGCAGGGGACACCATTAGGCTTGAGGCAGGGGTTAGAGGCAAACCATTCCCAGAA       c.62400
 V  K  A  G  D  T  I  R  L  E  A  G  V  R  G  K  P  F  P  E         p.20800

          .         .         .         .         .         .       g.246538
 GTTGCATGGACCAAGGACAAAGACGCTACAGACTTAACAAGATCACCAAGGGTCAAGATT       c.62460
 V  A  W  T  K  D  K  D  A  T  D  L  T  R  S  P  R  V  K  I         p.20820

          .         .         .         .         .         .       g.246598
 GATACCCGTGCTGATTCATCTAAATTTTCTCTTACTAAAGCAAAGCGAAGTGATGGGGGT       c.62520
 D  T  R  A  D  S  S  K  F  S  L  T  K  A  K  R  S  D  G  G         p.20840

          .         .         .         .         .         .       g.246658
 AAATATGTAGTTACGGCAACTAACACGGCTGGCAGTTTTGTGGCCTATGCCACTGTCAAT       c.62580
 K  Y  V  V  T  A  T  N  T  A  G  S  F  V  A  Y  A  T  V  N         p.20860

          .         .         .         .         .         .       g.246718
 GTTTTAGATAAGCCTGGTCCTGTGAGAAATCTGAAAATTGTTGATGTGTCCAGTGATAGG       c.62640
 V  L  D  K  P  G  P  V  R  N  L  K  I  V  D  V  S  S  D  R         p.20880

          .         .         .         .         .         .       g.246778
 TGTACTGTTTGCTGGGATCCACCAGAAGATGATGGTGGCTGTGAAATCCAAAATTATATT       c.62700
 C  T  V  C  W  D  P  P  E  D  D  G  G  C  E  I  Q  N  Y  I         p.20900

          .         .         .         .         .         .       g.246838
 CTAGAAAAATGTGAGACAAAGCGAATGGTTTGGTCTACCTATTCTGCTACTGTCTTGACA       c.62760
 L  E  K  C  E  T  K  R  M  V  W  S  T  Y  S  A  T  V  L  T         p.20920

          .         .         .         .         .         .       g.246898
 CCTGGTACTACAGTAACACGTCTCATAGAAGGAAATGAATATATTTTCAGAGTCCGTGCA       c.62820
 P  G  T  T  V  T  R  L  I  E  G  N  E  Y  I  F  R  V  R  A         p.20940

          .         .         .         .         .         .       g.246958
 GAAAATAAAATAGGCACAGGGCCTCCAACAGAAAGTAAACCAGTCATAGCCAAAACCAAG       c.62880
 E  N  K  I  G  T  G  P  P  T  E  S  K  P  V  I  A  K  T  K         p.20960

          .         .         .         .         .         .       g.247018
 TATGATAAACCTGGTCGCCCTGATCCCCCAGAAGTCACTAAAGTAAGCAAAGAAGAGATG       c.62940
 Y  D  K  P  G  R  P  D  P  P  E  V  T  K  V  S  K  E  E  M         p.20980

          .         .         .         .         .         .       g.247078
 ACTGTGGTTTGGAATCCACCTGAATATGATGGTGGAAAGTCTATAACTGGATACTTTTTG       c.63000
 T  V  V  W  N  P  P  E  Y  D  G  G  K  S  I  T  G  Y  F  L         p.21000

          .         .         .         .         .         .       g.247138
 GAGAAAAAGGAAAAGCATTCAACACGATGGGTCCCTGTCAACAAGAGTGCAATCCCTGAG       c.63060
 E  K  K  E  K  H  S  T  R  W  V  P  V  N  K  S  A  I  P  E         p.21020

          .         .         .         .         .         .       g.247198
 AGACGTATGAAAGTACAGAATCTCCTCCCAGACCATGAATATCAGTTCCGTGTCAAGGCA       c.63120
 R  R  M  K  V  Q  N  L  L  P  D  H  E  Y  Q  F  R  V  K  A         p.21040

          .         .         .         .         .         .       g.247258
 GAAAATGAAATTGGAATTGGAGAACCAAGCTTGCCTTCAAGACCGGTGGTGGCAAAAGAC       c.63180
 E  N  E  I  G  I  G  E  P  S  L  P  S  R  P  V  V  A  K  D         p.21060

         | 306         .         .         .         .         .    g.247636
 CCCATAG | AGCCACCTGGTCCACCAACCAATTTCAGAGTGGTTGATACAACCAAACATTCC    c.63240
 P  I  E |   P  P  G  P  P  T  N  F  R  V  V  D  T  T  K  H  S      p.21080

          .         .         .         .         .         .       g.247696
 ATAACTCTTGGGTGGGGAAAACCAGTCTATGATGGTGGTGCACCGATCATTGGATATGTT       c.63300
 I  T  L  G  W  G  K  P  V  Y  D  G  G  A  P  I  I  G  Y  V         p.21100

          .         .         .         .         .         .       g.247756
 GTGGAAATGAGACCAAAAATAGCAGATGCGTCTCCTGATGAAGGCTGGAAACGGTGTAAT       c.63360
 V  E  M  R  P  K  I  A  D  A  S  P  D  E  G  W  K  R  C  N         p.21120

          .         .         .         .         .         .       g.247816
 GCTGCAGCACAGCTTGTACGCAAGGAATTCACTGTTACCAGCTTGGATGAAAACCAGGAA       c.63420
 A  A  A  Q  L  V  R  K  E  F  T  V  T  S  L  D  E  N  Q  E         p.21140

          .         .         .         .         .         .       g.247876
 TATGAGTTCAGGGTGTGTGCCCAAAACCAAGTTGGTATTGGGCGCCCTGCAGAGCTAAAG       c.63480
 Y  E  F  R  V  C  A  Q  N  Q  V  G  I  G  R  P  A  E  L  K         p.21160

          .         .         | 307        .         .         .    g.248034
 GAAGCTATCAAACCTAAAGAAATACTAG | AACCTCCGGAGATTGATTTGGATGCCAGCATG    c.63540
 E  A  I  K  P  K  E  I  L  E |   P  P  E  I  D  L  D  A  S  M      p.21180

          .         .         .         .         .         .       g.248094
 AGGAAACTGGTCATAGTGAGAGCAGGATGCCCTATTCGTCTCTTTGCTATAGTGAGAGGA       c.63600
 R  K  L  V  I  V  R  A  G  C  P  I  R  L  F  A  I  V  R  G         p.21200

          .         .         .         .         .         .       g.248154
 CGACCAGCCCCTAAAGTCACTTGGCGAAAAGTTGGCATTGATAATGTGGTCAGAAAAGGA       c.63660
 R  P  A  P  K  V  T  W  R  K  V  G  I  D  N  V  V  R  K  G         p.21220

          .         .         .         .         .         .       g.248214
 CAAGTTGATCTGGTTGACACTATGGCCTTCCTTGTCATCCCCAATTCTACCCGTGATGAC       c.63720
 Q  V  D  L  V  D  T  M  A  F  L  V  I  P  N  S  T  R  D  D         p.21240

          .         .         .         .         .         .       g.248274
 TCAGGAAAATATTCCTTAACACTTGTGAACCCAGCAGGAGAAAAGGCTGTATTCGTAAAT       c.63780
 S  G  K  Y  S  L  T  L  V  N  P  A  G  E  K  A  V  F  V  N         p.21260

          .    | 308   .         .         .         .         .    g.248432
 GTCAGAGTATTAG | ACACTCCTGGGCCTGTGTCTGATTTAAAAGTTTCAGATGTCACTAAA    c.63840
 V  R  V  L  D |   T  P  G  P  V  S  D  L  K  V  S  D  V  T  K      p.21280

          .         .         .         .         .         .       g.248492
 ACATCATGCCATGTGTCCTGGGCCCCTCCTGAAAACGACGGTGGGAGCCAAGTGACACAT       c.63900
 T  S  C  H  V  S  W  A  P  P  E  N  D  G  G  S  Q  V  T  H         p.21300

          .         .         .         .         .         .       g.248552
 TATATCGTGGAGAAACGTGAGGCAGACAGAAAGACATGGTCGACCGTTACCCCAGAAGTT       c.63960
 Y  I  V  E  K  R  E  A  D  R  K  T  W  S  T  V  T  P  E  V         p.21320

          .         .         .         .         .         .       g.248612
 AAGAAAACAAGCTTCCATGTAACCAATCTTGTCCCTGGGAATGAGTATTACTTCAGAGTA       c.64020
 K  K  T  S  F  H  V  T  N  L  V  P  G  N  E  Y  Y  F  R  V         p.21340

          .         .         .         .         .         .       g.248672
 ACTGCTGTCAACGAATATGGCCCTGGCGTCCCAACAGATGTCCCAAAACCAGTGCTTGCA       c.64080
 T  A  V  N  E  Y  G  P  G  V  P  T  D  V  P  K  P  V  L  A         p.21360

          .    | 309   .         .         .         .         .    g.249042
 TCAGATCCTCTAA | GTGAGCCGGATCCCCCAAGGAAATTAGAAGTGACTGAAATGACCAAG    c.64140
 S  D  P  L  S |   E  P  D  P  P  R  K  L  E  V  T  E  M  T  K      p.21380

          .         .         .         .         .         .       g.249102
 AACAGTGCCACCTTAGCCTGGTTACCTCCCCTACGTGATGGAGGTGCTAAAATCGATGGC       c.64200
 N  S  A  T  L  A  W  L  P  P  L  R  D  G  G  A  K  I  D  G         p.21400

          .         .         .         .         .         .       g.249162
 TACATCACTAGTTACAGAGAAGAAGAGCAGCCTGCAGATCGCTGGACAGAGTACTCAGTG       c.64260
 Y  I  T  S  Y  R  E  E  E  Q  P  A  D  R  W  T  E  Y  S  V         p.21420

          .         .         .         .         .         .       g.249222
 GTAAAAGATCTGAGCCTTGTTGTCACTGGCCTAAAGGAAGGAAAGAAATACAAATTTAGA       c.64320
 V  K  D  L  S  L  V  V  T  G  L  K  E  G  K  K  Y  K  F  R         p.21440

          .         .         .         .         .         .       g.249282
 GTAGCGGCCAGAAATGCTGTTGGAGTCAGTTTGCCAAGAGAAGCTGAAGGAGTGTATGAA       c.64380
 V  A  A  R  N  A  V  G  V  S  L  P  R  E  A  E  G  V  Y  E         p.21460

          .       | 310.         .         .         .         .    g.250499
 GCCAAAGAACAACTGT | TGCCACCAAAGATCCTTATGCCAGAGCAAATAACTATCAAAGCT    c.64440
 A  K  E  Q  L  L |   P  P  K  I  L  M  P  E  Q  I  T  I  K  A      p.21480

          .         .         .         .         .         .       g.250559
 GGGAAAAAACTCCGAATTGAAGCCCATGTGTATGGAAAGCCTCATCCCACCTGTAAATGG       c.64500
 G  K  K  L  R  I  E  A  H  V  Y  G  K  P  H  P  T  C  K  W         p.21500

          .         .         .         .         .         .       g.250619
 AAAAAAGGAGAAGATGAAGTTGTCACATCCAGCCACCTGGCAGTGCATAAAGCAGACAGC       c.64560
 K  K  G  E  D  E  V  V  T  S  S  H  L  A  V  H  K  A  D  S         p.21520

          .         .         .         .         .         .       g.250679
 TCTTCAATTCTGATCATAAAAGATGTGACTAGGAAAGACAGTGGTTACTACAGCCTCACA       c.64620
 S  S  I  L  I  I  K  D  V  T  R  K  D  S  G  Y  Y  S  L  T         p.21540

          .         .         .         .         .   | 311    .    g.250842
 GCAGAGAACAGTTCTGGGACAGACACTCAGAAAATCAAAGTTGTAGTCATGG | ATGCCCCC    c.64680
 A  E  N  S  S  G  T  D  T  Q  K  I  K  V  V  V  M  D |   A  P      p.21560

          .         .         .         .         .         .       g.250902
 GGCCCCCCTCAGCCTCCATTTGACATTTCTGATATAGACGCTGATGCTTGCTCCCTGTCA       c.64740
 G  P  P  Q  P  P  F  D  I  S  D  I  D  A  D  A  C  S  L  S         p.21580

          .         .         .         .         .         .       g.250962
 TGGCACATCCCTCTGGAGGACGGAGGCAGTAACATCACCAATTATATAGTGGAGAAGTGT       c.64800
 W  H  I  P  L  E  D  G  G  S  N  I  T  N  Y  I  V  E  K  C         p.21600

          .         .         .         .         .         .       g.251022
 GATGTAAGCCGAGGTGACTGGGTCACGGCTCTAGCTTCAGTCACAAAAACTTCCTGCAGG       c.64860
 D  V  S  R  G  D  W  V  T  A  L  A  S  V  T  K  T  S  C  R         p.21620

          .         .         .         .         .         .       g.251082
 GTTGGAAAGCTGATCCCAGGCCAGGAGTACATCTTCCGGGTCCGTGCTGAAAACCGATTT       c.64920
 V  G  K  L  I  P  G  Q  E  Y  I  F  R  V  R  A  E  N  R  F         p.21640

          .         .         .         .         .   | 312    .    g.251232
 GGCATTTCAGAGCCTCTCACATCTCCAAAGATGGTTGCGCAGTTCCCATTTG | GTGTTCCT    c.64980
 G  I  S  E  P  L  T  S  P  K  M  V  A  Q  F  P  F  G |   V  P      p.21660

          .         .         .         .         .         .       g.251292
 AGTGAACCAAAGAATGCACGAGTCACCAAAGTCAACAAGGACTGTATTTTTGTTGCTTGG       c.65040
 S  E  P  K  N  A  R  V  T  K  V  N  K  D  C  I  F  V  A  W         p.21680

          .         .         .         .         .         .       g.251352
 GACAGACCAGATAGTGATGGAGGGAGCCCCATTATTGGTTATCTGATTGAACGCAAGGAA       c.65100
 D  R  P  D  S  D  G  G  S  P  I  I  G  Y  L  I  E  R  K  E         p.21700

          .         .         .         .         .         .       g.251412
 AGAAACAGTTTGCTGTGGGTGAAAGCCAATGATACTCTTGTCCGGTCAACTGAATATCCT       c.65160
 R  N  S  L  L  W  V  K  A  N  D  T  L  V  R  S  T  E  Y  P         p.21720

          .         .         .         .         .         .       g.251472
 TGTGCTGGCCTTGTAGAAGGTCTTGAGTATTCATTCAGAATCTATGCCCTAAACAAAGCT       c.65220
 C  A  G  L  V  E  G  L  E  Y  S  F  R  I  Y  A  L  N  K  A         p.21740

          .         .         .         .         .      | 313 .    g.251901
 GGATCCAGCCCACCCAGCAAACCCACAGAATATGTAACTGCAAGAATGCCAGTTG | ATCCT    c.65280
 G  S  S  P  P  S  K  P  T  E  Y  V  T  A  R  M  P  V  D |   P      p.21760

          .         .         .         .         .         .       g.251961
 CCTGGGAAACCTGAGGTTATTGATGTCACCAAGAGTACTGTATCTCTGATCTGGGCTCGT       c.65340
 P  G  K  P  E  V  I  D  V  T  K  S  T  V  S  L  I  W  A  R         p.21780

          .         .         .         .         .         .       g.252021
 CCAAAGCATGATGGAGGCAGTAAAATTATTGGCTATTTCGTAGAAGCTTGCAAACTTCCT       c.65400
 P  K  H  D  G  G  S  K  I  I  G  Y  F  V  E  A  C  K  L  P         p.21800

          .         .         .         .         .         .       g.252081
 GGTGATAAATGGGTACGGTGCAATACTGCACCTCACCAGATTCCCCAGGAAGAGTACACA       c.65460
 G  D  K  W  V  R  C  N  T  A  P  H  Q  I  P  Q  E  E  Y  T         p.21820

          .         .         .         .         .         .       g.252141
 GCTACTGGCCTAGAAGAGAAAGCTCAGTATCAATTTAGAGCTATTGCCAGGACCGCGGTA       c.65520
 A  T  G  L  E  E  K  A  Q  Y  Q  F  R  A  I  A  R  T  A  V         p.21840

          .         .         .         .         .      | 314 .    g.252580
 AACATTAGCCCACCTTCTGAACCTTCTGATCCAGTGACTATCCTCGCAGAAAATG | TCCCT    c.65580
 N  I  S  P  P  S  E  P  S  D  P  V  T  I  L  A  E  N  V |   P      p.21860

          .         .         .         .         .         .       g.252640
 CCCAGGATAGACCTGAGTGTGGCTATGAAATCTTTGCTTACTGTGAAAGCTGGAACTAAT       c.65640
 P  R  I  D  L  S  V  A  M  K  S  L  L  T  V  K  A  G  T  N         p.21880

          .         .         .         .         .         .       g.252700
 GTCTGCTTGGATGCTACTGTTTTTGGTAAACCGATGCCAACAGTTTCTTGGAAAAAAGAT       c.65700
 V  C  L  D  A  T  V  F  G  K  P  M  P  T  V  S  W  K  K  D         p.21900

          .         .         .         .         .         .       g.252760
 GGCACACTGCTAAAACCAGCAGAAGGCATAAAGATGGCCATGCAGCGGAATCTGTGCACC       c.65760
 G  T  L  L  K  P  A  E  G  I  K  M  A  M  Q  R  N  L  C  T         p.21920

          .         .         .         .         .         .       g.252820
 TTGGAGCTATTCAGCGTGAACCGGAAGGACTCAGGAGACTATACCATTACTGCTGAAAAT       c.65820
 L  E  L  F  S  V  N  R  K  D  S  G  D  Y  T  I  T  A  E  N         p.21940

          .         .         .         .    | 315   .         .    g.253227
 TCAAGTGGTTCTAAATCAGCCACCATTAAGCTTAAAGTGTTAG | ATAAACCGGGTCCTCCA    c.65880
 S  S  G  S  K  S  A  T  I  K  L  K  V  L  D |   K  P  G  P  P      p.21960

          .         .         .         .         .         .       g.253287
 GCATCTGTTAAAATCAACAAAATGTATTCAGATCGTGCTATGCTTTCTTGGGAACCGCCT       c.65940
 A  S  V  K  I  N  K  M  Y  S  D  R  A  M  L  S  W  E  P  P         p.21980

          .         .         .         .         .         .       g.253347
 CTTGAAGATGGAGGCTCAGAAATCACCAACTATATTGTTGACAAACGTGAAACAAGCAGG       c.66000
 L  E  D  G  G  S  E  I  T  N  Y  I  V  D  K  R  E  T  S  R         p.22000

          .         .         .         .         .         .       g.253407
 CCCAACTGGGCTCAAGTCTCTGCAACTGTGCCTATCACCAGCTGCAGCGTGGAGAAACTT       c.66060
 P  N  W  A  Q  V  S  A  T  V  P  I  T  S  C  S  V  E  K  L         p.22020

          .         .         .         .         .         .       g.253467
 ATAGAGGGCCATGAGTATCAGTTCCGTATTTGTGCTGAAAATAAATATGGAGTAGGCGAT       c.66120
 I  E  G  H  E  Y  Q  F  R  I  C  A  E  N  K  Y  G  V  G  D         p.22040

          .         .         .         . | 316      .         .    g.253614
 CCAGTCTTCACTGAACCAGCAATTGCCAAAAACCCATATG | ACCCACCAGGACGCTGTGAT    c.66180
 P  V  F  T  E  P  A  I  A  K  N  P  Y  D |   P  P  G  R  C  D      p.22060

          .         .         .         .         .         .       g.253674
 CCTCCTGTTATTAGCAACATAACCAAAGATCACATGACAGTCAGCTGGAAGCCACCAGCA       c.66240
 P  P  V  I  S  N  I  T  K  D  H  M  T  V  S  W  K  P  P  A         p.22080

          .         .         .         .         .         .       g.253734
 GATGATGGGGGCTCACCCATCACTGGCTATTTGCTTGAAAAGCGGGAAACCCAGGCTGTT       c.66300
 D  D  G  G  S  P  I  T  G  Y  L  L  E  K  R  E  T  Q  A  V         p.22100

          .         .         .         .         .         .       g.253794
 AACTGGACTAAGGTCAACAGAAAACCTATTATAGAAAGAACATTAAAAGCAACAGGTCTT       c.66360
 N  W  T  K  V  N  R  K  P  I  I  E  R  T  L  K  A  T  G  L         p.22120

          .         .         .         .         .         .       g.253854
 CAAGAAGGTACCGAATATGAGTTCCGTGTTACAGCTATAAATAAAGCTGGACCAGGCAAA       c.66420
 Q  E  G  T  E  Y  E  F  R  V  T  A  I  N  K  A  G  P  G  K         p.22140

          .         .         .         .    | 317   .         .    g.254015
 CCCAGTGACGCATCCAAGGCCGCTTATGCTCGGGACCCTCAGT | ATCCTCCTGGCCCACCG    c.66480
 P  S  D  A  S  K  A  A  Y  A  R  D  P  Q  Y |   P  P  G  P  P      p.22160

          .         .         .         .         .         .       g.254075
 GCTTTCCCTAAAGTATATGATACAACTCGCAGCTCTGTGAGTCTATCTTGGGGCAAGCCA       c.66540
 A  F  P  K  V  Y  D  T  T  R  S  S  V  S  L  S  W  G  K  P         p.22180

          .         .         .         .         .         .       g.254135
 GCCTATGACGGCGGCAGCCCTATCATTGGTTATCTCGTTGAAGTAAAACGGGCTGACTCC       c.66600
 A  Y  D  G  G  S  P  I  I  G  Y  L  V  E  V  K  R  A  D  S         p.22200

          .         .         .         .         .         .       g.254195
 GATAACTGGGTGAGGTGCAACTTACCACAGAATCTACAGAAAACCCGCTTTGAGGTTACT       c.66660
 D  N  W  V  R  C  N  L  P  Q  N  L  Q  K  T  R  F  E  V  T         p.22220

          .         .         .         .         .         .       g.254255
 GGCCTGATGGAAGACACACAATATCAATTCCGTGTGTATGCCGTTAATAAGATTGGATAC       c.66720
 G  L  M  E  D  T  Q  Y  Q  F  R  V  Y  A  V  N  K  I  G  Y         p.22240

          .         .         .         .          | 318       .    g.255204
 AGTGACCCCAGTGATGTGCCAGATAAACACTATCCCAAGGACATCTTAA | TTCCACCTGAG    c.66780
 S  D  P  S  D  V  P  D  K  H  Y  P  K  D  I  L  I |   P  P  E      p.22260

          .         .         .         .         .         .       g.255264
 GGAGAACTTGATGCGGACTTAAGGAAGACACTCATATTACGTGCTGGAGTTACTATGAGA       c.66840
 G  E  L  D  A  D  L  R  K  T  L  I  L  R  A  G  V  T  M  R         p.22280

          .         .         .         .         .         .       g.255324
 CTATATGTACCAGTAAAAGGACGCCCACCTCCAAAGATTACTTGGTCTAAACCAAATGTC       c.66900
 L  Y  V  P  V  K  G  R  P  P  P  K  I  T  W  S  K  P  N  V         p.22300

          .         .         .         .         .         .       g.255384
 AATCTAAGAGACAGGATTGGACTGGACATAAAGTCAACTGACTTTGACACTTTCTTGCGC       c.66960
 N  L  R  D  R  I  G  L  D  I  K  S  T  D  F  D  T  F  L  R         p.22320

          .         .         .         .         .         .       g.255444
 TGTGAAAATGTGAACAAATATGATGCAGGAAAATATATCTTAACCCTGGAGAACAGCTGT       c.67020
 C  E  N  V  N  K  Y  D  A  G  K  Y  I  L  T  L  E  N  S  C         p.22340

          .         .         .        | 319         .         .    g.255596
 GGTAAAAAGGAATATACCATTGTTGTGAAAGTGCTTG | ATACTCCTGGGCCACCTGTCAAT    c.67080
 G  K  K  E  Y  T  I  V  V  K  V  L  D |   T  P  G  P  P  V  N      p.22360

          .         .         .         .         .         .       g.255656
 GTGACTGTTAAGGAAATATCCAAAGACTCTGCTTATGTTACCTGGGAGCCTCCCATTATT       c.67140
 V  T  V  K  E  I  S  K  D  S  A  Y  V  T  W  E  P  P  I  I         p.22380

          .         .         .         .         .         .       g.255716
 GATGGCGGAAGCCCCATCATAAACTATGTGGTACAAAAACGTGATGCAGAGAGGAAATCC       c.67200
 D  G  G  S  P  I  I  N  Y  V  V  Q  K  R  D  A  E  R  K  S         p.22400

          .         .         .         .         .         .       g.255776
 TGGTCTACAGTGACAACTGAGTGCTCCAAAACAAGCTTCAGAGTAGCTAATTTGGAGGAG       c.67260
 W  S  T  V  T  T  E  C  S  K  T  S  F  R  V  A  N  L  E  E         p.22420

          .         .         .         .         .         .       g.255836
 GGAAAATCCTACTTCTTCCGAGTGTTTGCTGAAAATGAGTATGGCATTGGTGATCCCGGT       c.67320
 G  K  S  Y  F  F  R  V  F  A  E  N  E  Y  G  I  G  D  P  G         p.22440

          .         .         | 320        .         .         .    g.255986
 GAAACTCGTGATGCTGTCAAAGCTTCCC | AAACTCCTGGACCAGTTGTGGACCTGAAAGTG    c.67380
 E  T  R  D  A  V  K  A  S  Q |   T  P  G  P  V  V  D  L  K  V      p.22460

          .         .         .         .         .         .       g.256046
 AGGTCTGTATCTAAGTCATCCTGTAGCATTGGCTGGAAAAAGCCTCACAGTGATGGTGGA       c.67440
 R  S  V  S  K  S  S  C  S  I  G  W  K  K  P  H  S  D  G  G         p.22480

          .         .         .         .         .         .       g.256106
 AGTCGGATTATTGGATATGTAGTTGATTTCCTGACTGAAGAAAATAAGTGGCAACGAGTT       c.67500
 S  R  I  I  G  Y  V  V  D  F  L  T  E  E  N  K  W  Q  R  V         p.22500

          .         .         .         .         .         .       g.256166
 ATGAAATCCTTAAGCCTACAGTACTCTGCAAAAGATTTGACTGAAGGGAAGGAATATACC       c.67560
 M  K  S  L  S  L  Q  Y  S  A  K  D  L  T  E  G  K  E  Y  T         p.22520

          .         .         .         .         .         .       g.256226
 TTCAGAGTGAGTGCTGAGAATGAAAATGGAGAAGGAACCCCAAGCGAAATCACTGTTGTG       c.67620
 F  R  V  S  A  E  N  E  N  G  E  G  T  P  S  E  I  T  V  V         p.22540

          .       | 321.         .         .         .         .    g.256453
 GCAAGGGATGATGTTG | TGGCTCCTGATCTTGACTTAAAGGGTCTACCTGATTTGTGCTAC    c.67680
 A  R  D  D  V  V |   A  P  D  L  D  L  K  G  L  P  D  L  C  Y      p.22560

          .         .         .         .         .         .       g.256513
 TTGGCTAAAGAAAACAGCAACTTCCGGCTTAAGATCCCCATAAAAGGCAAGCCAGCTCCA       c.67740
 L  A  K  E  N  S  N  F  R  L  K  I  P  I  K  G  K  P  A  P         p.22580

          .         .         .         .         .         .       g.256573
 TCAGTCTCCTGGAAGAAAGGGGAAGATCCTCTAGCAACTGACACTAGAGTCAGTGTTGAG       c.67800
 S  V  S  W  K  K  G  E  D  P  L  A  T  D  T  R  V  S  V  E         p.22600

          .         .         .         .         .         .       g.256633
 TCATCTGCGGTTAACACAACTCTTATAGTGTACGATTGCCAAAAATCTGATGCTGGAAAA       c.67860
 S  S  A  V  N  T  T  L  I  V  Y  D  C  Q  K  S  D  A  G  K         p.22620

          .         .         .         .         .         .       g.256693
 TACACAATCACACTTAAGAATGTTGCTGGCACCAAGGAAGGAACTATCTCCATAAAGGTT       c.67920
 Y  T  I  T  L  K  N  V  A  G  T  K  E  G  T  I  S  I  K  V         p.22640

          .         .         .         .         .         .       g.256753
 GTTGGCAAGCCTGGCATCCCCACTGGACCAATCAAATTTGATGAAGTCACAGCAGAAGCC       c.67980
 V  G  K  P  G  I  P  T  G  P  I  K  F  D  E  V  T  A  E  A         p.22660

          .         .         .         .         .         .       g.256813
 ATGACCTTAAAGTGGGCTCCTCCAAAGGATGATGGAGGTTCTGAAATCACCAACTATATC       c.68040
 M  T  L  K  W  A  P  P  K  D  D  G  G  S  E  I  T  N  Y  I         p.22680

          .         .         .         .         .         .       g.256873
 CTAGAGAAGAGGGATTCTGTGAACAACAAGTGGGTGACGTGCGCCTCAGCTGTCCAGAAA       c.68100
 L  E  K  R  D  S  V  N  N  K  W  V  T  C  A  S  A  V  Q  K         p.22700

          .         .         .         .         .         .       g.256933
 ACCACCTTTAGAGTAACCAGACTTCATGAGGGCATGGAATATACCTTCAGGGTCAGTGCC       c.68160
 T  T  F  R  V  T  R  L  H  E  G  M  E  Y  T  F  R  V  S  A         p.22720

          .         .         .         .         .         .       g.256993
 GAAAATAAATATGGTGTAGGGGAAGGCCTGAAATCGGAGCCAATTGTTGCGAGACATCCA       c.68220
 E  N  K  Y  G  V  G  E  G  L  K  S  E  P  I  V  A  R  H  P         p.22740

      | 322  .         .         .         .         .         .    g.257143
 TTTG | ATGTGCCTGATGCTCCCCCACCTCCCAATATTGTGGATGTCAGACACGATTCAGTA    c.68280
 F  D |   V  P  D  A  P  P  P  P  N  I  V  D  V  R  H  D  S  V      p.22760

          .         .         .         .          | 323       .    g.257628
 TCTCTAACTTGGACTGACCCCAAGAAAACTGGTGGTTCTCCAATTACAG | GGTATCATCTC    c.68340
 S  L  T  W  T  D  P  K  K  T  G  G  S  P  I  T  G |   Y  H  L      p.22780

          .         .         .         .         .         .       g.257688
 GAGTTCAAGGAAAGAAACAGCCTTTTGTGGAAGAGAGCTAACAAGACTCCGATAAGGATG       c.68400
 E  F  K  E  R  N  S  L  L  W  K  R  A  N  K  T  P  I  R  M         p.22800

          .         .         .         .         .         .       g.257748
 AGAGACTTTAAAGTGACAGGATTAACTGAAGGTCTTGAATATGAATTCCGAGTTATGGCA       c.68460
 R  D  F  K  V  T  G  L  T  E  G  L  E  Y  E  F  R  V  M  A         p.22820

          .         .         .         .         .         .       g.257808
 ATCAATTTAGCAGGTGTGGGCAAGCCAAGCCTACCATCAGAGCCTGTTGTGGCACTGGAC       c.68520
 I  N  L  A  G  V  G  K  P  S  L  P  S  E  P  V  V  A  L  D         p.22840

         | 324         .         .         .         .         .    g.257957
 CCAATTG | ATCCTCCTGGAAAACCTGAGGTTATTAACATAACAAGGAATTCAGTGACTCTC    c.68580
 P  I  D |   P  P  G  K  P  E  V  I  N  I  T  R  N  S  V  T  L      p.22860

          .         .         .         .         .         .       g.258017
 ATTTGGACTGAACCTAAATATGACGGTGGTCATAAGTTAACTGGATATATAGTGGAGAAG       c.68640
 I  W  T  E  P  K  Y  D  G  G  H  K  L  T  G  Y  I  V  E  K         p.22880

          .         .         .         .         .         .       g.258077
 CGAGATCTACCTTCGAAGTCTTGGATGAAAGCCAACCATGTTAATGTCCCAGAATGTGCC       c.68700
 R  D  L  P  S  K  S  W  M  K  A  N  H  V  N  V  P  E  C  A         p.22900

          .         .         .         .         .         .       g.258137
 TTTACTGTAACTGACCTTGTTGAGGGTGGAAAATATGAATTCAGAATTAGAGCAAAGAAT       c.68760
 F  T  V  T  D  L  V  E  G  G  K  Y  E  F  R  I  R  A  K  N         p.22920

          .         .         .         .         .         .       g.258197
 ACAGCAGGTGCTATCAGTGCTCCATCAGAAAGTACAGAAACCATTATTTGCAAGGATGAA       c.68820
 T  A  G  A  I  S  A  P  S  E  S  T  E  T  I  I  C  K  D  E         p.22940

      | 325  .         .         .         .         .         .    g.258348
 TACG | AGGCACCAACAATTGTCCTTGATCCCACAATAAAAGATGGGCTAACAATTAAAGCA    c.68880
 Y  E |   A  P  T  I  V  L  D  P  T  I  K  D  G  L  T  I  K  A      p.22960

          .         .         .         .         .         .       g.258408
 GGGGATACCATTGTTTTGAATGCCATTAGCATTCTTGGCAAACCCCTTCCAAAATCAAGT       c.68940
 G  D  T  I  V  L  N  A  I  S  I  L  G  K  P  L  P  K  S  S         p.22980

          .         .         .         .         .         .       g.258468
 TGGTCCAAGGCAGGAAAAGACATTAGACCATCAGATATCACTCAGATAACTTCAACCCCA       c.69000
 W  S  K  A  G  K  D  I  R  P  S  D  I  T  Q  I  T  S  T  P         p.23000

          .         .         .         .         .         .       g.258528
 ACATCTTCCATGCTTACTATCAAGTATGCCACTAGAAAAGATGCGGGTGAATATACCATC       c.69060
 T  S  S  M  L  T  I  K  Y  A  T  R  K  D  A  G  E  Y  T  I         p.23020

          .         .         .         .         .         .       g.258588
 ACTGCTACCAATCCTTTTGGCACGAAGGTGGAACATGTGAAGGTAACAGTCCTTGATGTA       c.69120
 T  A  T  N  P  F  G  T  K  V  E  H  V  K  V  T  V  L  D  V         p.23040

          .         .         .         .         .         .       g.258648
 CCTGGTCCCCCAGGTCCTGTTGAAATCAGTAATGTTTCTGCTGAAAAAGCAACACTTACA       c.69180
 P  G  P  P  G  P  V  E  I  S  N  V  S  A  E  K  A  T  L  T         p.23060

          .         .         .         .         .         .       g.258708
 TGGACACCTCCCTTGGAAGATGGCGGCTCACCAATTAAGTCCTATATACTTGAAAAGAGA       c.69240
 W  T  P  P  L  E  D  G  G  S  P  I  K  S  Y  I  L  E  K  R         p.23080

          .         .         .         .         .         .       g.258768
 GAAACCAGCCGACTTTTGTGGACAGTGGTTTCTGAAGATATTCAGTCTTGCAGGCATGTG       c.69300
 E  T  S  R  L  L  W  T  V  V  S  E  D  I  Q  S  C  R  H  V         p.23100

          .         .         .         .         .         .       g.258828
 GCAACCAAACTTATCCAAGGAAATGAGTACATCTTCCGGGTCTCAGCTGTAAACCACTAT       c.69360
 A  T  K  L  I  Q  G  N  E  Y  I  F  R  V  S  A  V  N  H  Y         p.23120

          .         .         .         .         .   | 326    .    g.258979
 GGCAAAGGAGAACCTGTACAGTCTGAACCTGTCAAAATGGTAGACAGATTTG | GTCCCCCT    c.69420
 G  K  G  E  P  V  Q  S  E  P  V  K  M  V  D  R  F  G |   P  P      p.23140

          .         .         .         .         .         .       g.259039
 GGCCCTCCTGAAAAACCAGAGGTATCAAATGTCACTAAGAACACTGCCACTGTCAGCTGG       c.69480
 G  P  P  E  K  P  E  V  S  N  V  T  K  N  T  A  T  V  S  W         p.23160

          .         .         .         .         .         .       g.259099
 AAAAGGCCAGTGGATGATGGTGGCAGCGAAATTACAGGATATCATGTAGAAAGGAGAGAA       c.69540
 K  R  P  V  D  D  G  G  S  E  I  T  G  Y  H  V  E  R  R  E         p.23180

          .         .         .         .         .         .       g.259159
 AAGAAAAGCCTGCGATGGGTGAGAGCAATAAAAACACCAGTTTCCGATCTCAGGTGCAAA       c.69600
 K  K  S  L  R  W  V  R  A  I  K  T  P  V  S  D  L  R  C  K         p.23200

          .         .         .         .         .         .       g.259219
 GTAACAGGACTGCAAGAAGGAAGCACCTACGAATTCCGTGTCAGTGCAGAAAACAGAGCA       c.69660
 V  T  G  L  Q  E  G  S  T  Y  E  F  R  V  S  A  E  N  R  A         p.23220

          .         .         .         .         .      | 327 .    g.259391
 GGAATTGGTCCACCCAGTGAGGCTTCAGATTCTGTTCTGATGAAAGATGCAGCAT | ATCCT    c.69720
 G  I  G  P  P  S  E  A  S  D  S  V  L  M  K  D  A  A  Y |   P      p.23240

          .         .         .         .         .         .       g.259451
 CCAGGACCACCTTCAAATCCGCATGTCACTGATACTACCAAGAAATCTGCTTCTTTGGCA       c.69780
 P  G  P  P  S  N  P  H  V  T  D  T  T  K  K  S  A  S  L  A         p.23260

          .         .         .         .         .         .       g.259511
 TGGGGCAAGCCTCATTATGATGGTGGACTTGAAATCACTGGCTATGTCGTGGAGCATCAA       c.69840
 W  G  K  P  H  Y  D  G  G  L  E  I  T  G  Y  V  V  E  H  Q         p.23280

          .         .         .         .         .         .       g.259571
 AAAGTAGGAGACGAGGCCTGGATAAAAGATACCACAGGAACCGCCCTCAGAATCACTCAG       c.69900
 K  V  G  D  E  A  W  I  K  D  T  T  G  T  A  L  R  I  T  Q         p.23300

          .         .         .         .         .         .       g.259631
 TTCGTTGTTCCTGATCTTCAGACTAAAGAAAAATACAACTTCAGAATCAGTGCCATCAAC       c.69960
 F  V  V  P  D  L  Q  T  K  E  K  Y  N  F  R  I  S  A  I  N         p.23320

          .         .         .         .         .         .       g.259691
 GATGCAGGTGTTGGGGAGCCAGCGGTGATTCCAGATGTTGAAATCGTAGAACGGGAGATG       c.70020
 D  A  G  V  G  E  P  A  V  I  P  D  V  E  I  V  E  R  E  M         p.23340

          .         .         .         .         .         .       g.259751
 GCTCCTGATTTTGAACTAGATGCCGAGCTTCGAAGAACACTTGTTGTTAGAGCAGGACTC       c.70080
 A  P  D  F  E  L  D  A  E  L  R  R  T  L  V  V  R  A  G  L         p.23360

          .         .         .         .         .         .       g.259811
 AGTATTAGGATATTTGTGCCAATTAAAGGTCGTCCTGCTCCTGAAGTGACATGGACCAAA       c.70140
 S  I  R  I  F  V  P  I  K  G  R  P  A  P  E  V  T  W  T  K         p.23380

          .         .         .         .         .         .       g.259871
 GATAACATCAACCTGAAAAACCGAGCCAACATTGAAAATACGGAATCATTTACTCTTCTG       c.70200
 D  N  I  N  L  K  N  R  A  N  I  E  N  T  E  S  F  T  L  L         p.23400

          .         .         .         .         .         .       g.259931
 ATTATCCCAGAATGTAACAGATATGATACCGGTAAATTTGTCATGACCATTGAAAACCCG       c.70260
 I  I  P  E  C  N  R  Y  D  T  G  K  F  V  M  T  I  E  N  P         p.23420

          .         .         .         .         .         .       g.259991
 GCTGGGAAGAAAAGTGGCTTTGTGAACGTCAGAGTCTTGGACACGCCAGGCCCAGTCCTC       c.70320
 A  G  K  K  S  G  F  V  N  V  R  V  L  D  T  P  G  P  V  L         p.23440

          .         .         .         .         .         .       g.260051
 AACCTGCGGCCTACAGACATCACAAAGGACAGTGTCACCCTGCACTGGGACCTCCCTCTG       c.70380
 N  L  R  P  T  D  I  T  K  D  S  V  T  L  H  W  D  L  P  L         p.23460

          .         .         .         .         .         .       g.260111
 ATAGATGGAGGCTCACGTATAACAAACTACATTGTAGAGAAACGTGAAGCAACACGGAAA       c.70440
 I  D  G  G  S  R  I  T  N  Y  I  V  E  K  R  E  A  T  R  K         p.23480

          .         .         .         .         .         .       g.260171
 TCTTATTCCACAGCCACCACTAAGTGCCATAAATGCACATATAAAGTTACCGGCTTGTCT       c.70500
 S  Y  S  T  A  T  T  K  C  H  K  C  T  Y  K  V  T  G  L  S         p.23500

          .         .         .         .         .         .       g.260231
 GAAGGGTGTGAATATTTCTTCAGAGTGATGGCAGAGAATGAATATGGAATTGGTGAGCCA       c.70560
 E  G  C  E  Y  F  F  R  V  M  A  E  N  E  Y  G  I  G  E  P         p.23520

          .         .         .         .         .         .       g.260291
 ACAGAAACTACAGAGCCCGTAAAAGCCTCTGAAGCACCATCTCCACCAGACAGCCTTAAC       c.70620
 T  E  T  T  E  P  V  K  A  S  E  A  P  S  P  P  D  S  L  N         p.23540

          .         .         .         .         .         .       g.260351
 ATCATGGACATAACTAAGAGCACCGTCAGCCTGGCATGGCCTAAGCCCAAACACGATGGT       c.70680
 I  M  D  I  T  K  S  T  V  S  L  A  W  P  K  P  K  H  D  G         p.23560

          .         .         .         .         .         .       g.260411
 GGCAGCAAGATCACTGGCTATGTGATTGAAGCCCAAAGAAAAGGCTCTGACCAGTGGACC       c.70740
 G  S  K  I  T  G  Y  V  I  E  A  Q  R  K  G  S  D  Q  W  T         p.23580

          .         .         .         .         .         .       g.260471
 CACATCACAACCGTGAAAGGGTTAGAATGTGTTGTGAGGAATCTAACTGAAGGAGAGGAA       c.70800
 H  I  T  T  V  K  G  L  E  C  V  V  R  N  L  T  E  G  E  E         p.23600

          .         .         .         .         .         .       g.260531
 TATACCTTCCAAGTGATGGCAGTGAACAGCGCGGGGAGAAGTGCCCCTAGAGAAAGCAGA       c.70860
 Y  T  F  Q  V  M  A  V  N  S  A  G  R  S  A  P  R  E  S  R         p.23620

          .         .         .         .         .         .       g.260591
 CCCGTCATTGTCAAGGAGCAGACAATGCTTCCAGAGCTGGATCTCCGTGGCATCTATCAG       c.70920
 P  V  I  V  K  E  Q  T  M  L  P  E  L  D  L  R  G  I  Y  Q         p.23640

          .         .         .         .         .         .       g.260651
 AAACTGGTCATTGCCAAAGCTGGTGACAACATCAAAGTTGAAATTCCAGTGCTCGGTCGA       c.70980
 K  L  V  I  A  K  A  G  D  N  I  K  V  E  I  P  V  L  G  R         p.23660

          .         .         .         .         .         .       g.260711
 CCGAAGCCCACAGTGACATGGAAAAAAGGAGACCAAATTCTTAAACAGACACAGAGAGTT       c.71040
 P  K  P  T  V  T  W  K  K  G  D  Q  I  L  K  Q  T  Q  R  V         p.23680

          .         .         .         .         .         .       g.260771
 AATTTTGAAACCACAGCGACTTCAACCATTTTAAATATCAATGAGTGTGTCAGAAGTGAT       c.71100
 N  F  E  T  T  A  T  S  T  I  L  N  I  N  E  C  V  R  S  D         p.23700

          .         .         .         .         .         .       g.260831
 AGTGGGCCCTATCCATTAACAGCAAGGAACATTGTAGGAGAGGTTGGTGATGTCATCACC       c.71160
 S  G  P  Y  P  L  T  A  R  N  I  V  G  E  V  G  D  V  I  T         p.23720

          .         .         .         .         .         .       g.260891
 ATTCAAGTCCATGATATCCCAGGGCCACCTACTGGACCAATCAAATTTGATGAAGTTTCA       c.71220
 I  Q  V  H  D  I  P  G  P  P  T  G  P  I  K  F  D  E  V  S         p.23740

          .         .         .         .         .         .       g.260951
 TCTGATTTTGTAACCTTCTCTTGGGACCCACCTGAGAACGATGGTGGTGTACCAATAAGC       c.71280
 S  D  F  V  T  F  S  W  D  P  P  E  N  D  G  G  V  P  I  S         p.23760

          .         .         .         .         .         .       g.261011
 AACTATGTAGTGGAAATGCGGCAGACTGACAGTACTACCTGGGTTGAGTTAGCAACCACC       c.71340
 N  Y  V  V  E  M  R  Q  T  D  S  T  T  W  V  E  L  A  T  T         p.23780

          .         .         .         .         .         .       g.261071
 GTTATACGTACTACCTATAAAGCCACCCGCCTTACTACTGGATTAGAGTATCAGTTCCGT       c.71400
 V  I  R  T  T  Y  K  A  T  R  L  T  T  G  L  E  Y  Q  F  R         p.23800

          .         .         .         .         .         .       g.261131
 GTAAAAGCTCAGAATAGATATGGAGTTGGACCAGGCATCACATCAGCATGCATAGTTGCC       c.71460
 V  K  A  Q  N  R  Y  G  V  G  P  G  I  T  S  A  C  I  V  A         p.23820

          .         .         .         .         .         .       g.261191
 AACTATCCATTTAAGGTTCCTGGACCTCCTGGTACCCCTCAGGTAACTGCAGTTACCAAG       c.71520
 N  Y  P  F  K  V  P  G  P  P  G  T  P  Q  V  T  A  V  T  K         p.23840

          .         .         .         .         .         .       g.261251
 GATTCAATGACAATTAGCTGGCATGAGCCACTTTCTGATGGTGGAAGCCCCATTTTAGGA       c.71580
 D  S  M  T  I  S  W  H  E  P  L  S  D  G  G  S  P  I  L  G         p.23860

          .         .         .         .         .         .       g.261311
 TATCATGTTGAAAGAAAAGAACGAAATGGTATTCTCTGGCAGACTGTGAGCAAAGCTTTA       c.71640
 Y  H  V  E  R  K  E  R  N  G  I  L  W  Q  T  V  S  K  A  L         p.23880

          .         .         .         .         .         .       g.261371
 GTACCAGGCAACATTTTCAAATCAAGTGGACTTACAGATGGTATTGCTTATGAGTTCCGG       c.71700
 V  P  G  N  I  F  K  S  S  G  L  T  D  G  I  A  Y  E  F  R         p.23900

          .         .         .         .         .         .       g.261431
 GTGATTGCAGAAAACATGGCAGGCAAAAGTAAGCCAAGCAAGCCATCAGAACCTATGTTG       c.71760
 V  I  A  E  N  M  A  G  K  S  K  P  S  K  P  S  E  P  M  L         p.23920

          .         .         .         .         .         .       g.261491
 GCTCTGGATCCCATTGACCCACCTGGAAAACCAGTACCTCTAAATATTACAAGACACACA       c.71820
 A  L  D  P  I  D  P  P  G  K  P  V  P  L  N  I  T  R  H  T         p.23940

          .         .         .         .         .         .       g.261551
 GTAACACTTAAATGGGCTAAGCCTGAATATACTGGGGGCTTTAAAATTACCAGTTATATC       c.71880
 V  T  L  K  W  A  K  P  E  Y  T  G  G  F  K  I  T  S  Y  I         p.23960

          .         .         .         .         .         .       g.261611
 GTTGAAAAGAGAGACCTTCCTAATGGACGGTGGCTGAAGGCCAACTTCAGCAACATTTTG       c.71940
 V  E  K  R  D  L  P  N  G  R  W  L  K  A  N  F  S  N  I  L         p.23980

          .         .         .         .         .         .       g.261671
 GAGAATGAATTTACAGTCAGTGGCCTAACAGAAGATGCTGCATATGAATTCCGTGTGATC       c.72000
 E  N  E  F  T  V  S  G  L  T  E  D  A  A  Y  E  F  R  V  I         p.24000

          .         .         .         .         .         .       g.261731
 GCCAAAAATGCTGCAGGTGCCATCAGTCCACCATCTGAGCCATCTGATGCTATCACTTGC       c.72060
 A  K  N  A  A  G  A  I  S  P  P  S  E  P  S  D  A  I  T  C         p.24020

          .         .         .         .         .         .       g.261791
 AGGGATGATGTTGAGGCACCAAAGATAAAGGTGGATGTTAAATTTAAGGACACGGTTATA       c.72120
 R  D  D  V  E  A  P  K  I  K  V  D  V  K  F  K  D  T  V  I         p.24040

          .         .         .         .         .         .       g.261851
 TTAAAAGCAGGTGAAGCATTCAGACTGGAAGCTGATGTTTCAGGCCGCCCACCTCCAACA       c.72180
 L  K  A  G  E  A  F  R  L  E  A  D  V  S  G  R  P  P  P  T         p.24060

          .         .         .         .         .         .       g.261911
 ATGGAATGGAGCAAAGATGGAAAAGAGCTGGAAGGCACAGCAAAGTTAGAAATAAAAATT       c.72240
 M  E  W  S  K  D  G  K  E  L  E  G  T  A  K  L  E  I  K  I         p.24080

          .         .         .         .         .         .       g.261971
 GCAGATTTCTCTACTAATCTGGTAAACAAAGATTCAACAAGAAGGGATAGTGGTGCCTAT       c.72300
 A  D  F  S  T  N  L  V  N  K  D  S  T  R  R  D  S  G  A  Y         p.24100

          .         .         .         .         .         .       g.262031
 ACCCTTACAGCGACTAATCCTGGTGGCTTTGCTAAACACATTTTCAATGTCAAAGTTCTT       c.72360
 T  L  T  A  T  N  P  G  G  F  A  K  H  I  F  N  V  K  V  L         p.24120

          .         .         .         .         .         .       g.262091
 GACAGACCAGGCCCACCTGAAGGACCTTTGGCTGTAACTGAAGTGACATCAGAAAAGTGT       c.72420
 D  R  P  G  P  P  E  G  P  L  A  V  T  E  V  T  S  E  K  C         p.24140

          .         .         .         .         .         .       g.262151
 GTACTATCATGGTTCCCTCCACTGGATGATGGAGGTGCCAAAATTGATCATTACATAGTA       c.72480
 V  L  S  W  F  P  P  L  D  D  G  G  A  K  I  D  H  Y  I  V         p.24160

          .         .         .         .         .         .       g.262211
 CAGAAACGTGAAACCAGCAGATTGGCATGGACAAATGTAGCCTCAGAAGTCCAAGTAACA       c.72540
 Q  K  R  E  T  S  R  L  A  W  T  N  V  A  S  E  V  Q  V  T         p.24180

          .         .         .         .         .         .       g.262271
 AAGCTAAAGGTCACTAAACTCTTGAAAGGCAATGAATACATATTCCGTGTCATGGCTGTA       c.72600
 K  L  K  V  T  K  L  L  K  G  N  E  Y  I  F  R  V  M  A  V         p.24200

          .         .         .         .         .         .       g.262331
 AATAAATATGGAGTGGGAGAGCCACTGGAATCAGAGCCTGTGCTTGCAGTGAATCCTTAT       c.72660
 N  K  Y  G  V  G  E  P  L  E  S  E  P  V  L  A  V  N  P  Y         p.24220

          .         .         .         .         .         .       g.262391
 GGACCCCCTGATCCGCCCAAAAACCCTGAAGTGACAACTATTACTAAAGATTCGATGGTT       c.72720
 G  P  P  D  P  P  K  N  P  E  V  T  T  I  T  K  D  S  M  V         p.24240

          .         .         .         .         .         .       g.262451
 GTCTGCTGGGGACATCCTGATTCTGATGGTGGAAGTGAAATCATCAATTATATTGTGGAA       c.72780
 V  C  W  G  H  P  D  S  D  G  G  S  E  I  I  N  Y  I  V  E         p.24260

          .         .         .         .         .         .       g.262511
 CGGCGTGATAAAGCTGGCCAACGCTGGATTAAATGCAACAAAAAAACTCTTACTGATTTA       c.72840
 R  R  D  K  A  G  Q  R  W  I  K  C  N  K  K  T  L  T  D  L         p.24280

          .         .         .         .         .         .       g.262571
 AGATATAAAGTGTCTGGACTGACAGAAGGACATGAATATGAGTTCAGGATTATGGCTGAA       c.72900
 R  Y  K  V  S  G  L  T  E  G  H  E  Y  E  F  R  I  M  A  E         p.24300

          .         .         .         .         .         .       g.262631
 AATGCTGCTGGAATTAGTGCACCAAGTCCTACCAGTCCATTTTACAAGGCTTGTGACACT       c.72960
 N  A  A  G  I  S  A  P  S  P  T  S  P  F  Y  K  A  C  D  T         p.24320

          .         .         .         .         .         .       g.262691
 GTGTTTAAACCTGGACCACCAGGTAACCCACGTGTTCTGGATACAAGCAGATCATCCATT       c.73020
 V  F  K  P  G  P  P  G  N  P  R  V  L  D  T  S  R  S  S  I         p.24340

          .         .         .         .         .         .       g.262751
 TCAATCGCTTGGAATAAACCTATCTATGATGGTGGTTCAGAAATCACTGGGTATATGGTT       c.73080
 S  I  A  W  N  K  P  I  Y  D  G  G  S  E  I  T  G  Y  M  V         p.24360

          .         .         .         .         .         .       g.262811
 GAGATTGCCCTGCCAGAGGAAGATGAATGGCAGATTGTCACTCCACCAGCAGGACTCAAG       c.73140
 E  I  A  L  P  E  E  D  E  W  Q  I  V  T  P  P  A  G  L  K         p.24380

          .         .         .         .         .         .       g.262871
 GCAACTTCGTATACTATCACTGGCCTCACAGAGAATCAGGAATATAAGATCCGCATCTAT       c.73200
 A  T  S  Y  T  I  T  G  L  T  E  N  Q  E  Y  K  I  R  I  Y         p.24400

          .         .         .         .         .         .       g.262931
 GCCATGAATTCCGAAGGACTTGGGGAACCTGCCCTTGTTCCTGGAACTCCAAAGGCTGAA       c.73260
 A  M  N  S  E  G  L  G  E  P  A  L  V  P  G  T  P  K  A  E         p.24420

          .         .         .         .         .         .       g.262991
 GACAGAATGCTGCCTCCAGAAATTGAACTGGATGCTGACCTGCGCAAAGTTGTTACTATA       c.73320
 D  R  M  L  P  P  E  I  E  L  D  A  D  L  R  K  V  V  T  I         p.24440

          .         .         .         .         .         .       g.263051
 AGGGCCTGCTGCACCCTGAGACTTTTTGTTCCCATCAAAGGAAGGCCTGCACCTGAGGTG       c.73380
 R  A  C  C  T  L  R  L  F  V  P  I  K  G  R  P  A  P  E  V         p.24460

          .         .         .         .         .         .       g.263111
 AAGTGGGCCCGGGACCATGGAGAATCTTTAGATAAAGCTAGCATCGAATCCACAAGCTCT       c.73440
 K  W  A  R  D  H  G  E  S  L  D  K  A  S  I  E  S  T  S  S         p.24480

          .         .         .         .         .         .       g.263171
 TACACCCTGCTTATTGTTGGAAATGTAAACAGATTTGACAGTGGCAAATATATACTAACT       c.73500
 Y  T  L  L  I  V  G  N  V  N  R  F  D  S  G  K  Y  I  L  T         p.24500

          .         .         .         .         .         .       g.263231
 GTAGAAAATAGTTCAGGCAGCAAGTCTGCATTTGTCAATGTTAGAGTTCTCGATACACCA       c.73560
 V  E  N  S  S  G  S  K  S  A  F  V  N  V  R  V  L  D  T  P         p.24520

          .         .         .         .         .         .       g.263291
 GGCCCCCCACAGGATCTGAAGGTAAAAGAGGTCACTAAGACATCTGTCACACTCACATGG       c.73620
 G  P  P  Q  D  L  K  V  K  E  V  T  K  T  S  V  T  L  T  W         p.24540

          .         .         .         .         .         .       g.263351
 GACCCACCTCTCCTTGATGGAGGTTCAAAAATCAAGAACTATATTGTTGAAAAGCGGGAA       c.73680
 D  P  P  L  L  D  G  G  S  K  I  K  N  Y  I  V  E  K  R  E         p.24560

          .         .         .         .         .         .       g.263411
 TCAACAAGAAAAGCATATTCAACTGTTGCAACAAACTGCCACAAGACTTCCTGGAAGGTA       c.73740
 S  T  R  K  A  Y  S  T  V  A  T  N  C  H  K  T  S  W  K  V         p.24580

          .         .         .         .         .         .       g.263471
 GACCAGCTTCAAGAAGGCTGTAGCTACTATTTCAGGGTTCTCGCAGAAAATGAATATGGC       c.73800
 D  Q  L  Q  E  G  C  S  Y  Y  F  R  V  L  A  E  N  E  Y  G         p.24600

          .         .         .         .         .         .       g.263531
 ATTGGGCTGCCTGCTGAAACCGCAGAATCTGTGAAAGCATCAGAACGACCTCTTCCTCCA       c.73860
 I  G  L  P  A  E  T  A  E  S  V  K  A  S  E  R  P  L  P  P         p.24620

          .         .         .         .         .         .       g.263591
 GGAAAAATAACTTTGATGGATGTCACAAGAAATAGTGTGTCACTCTCTTGGGAGAAACCA       c.73920
 G  K  I  T  L  M  D  V  T  R  N  S  V  S  L  S  W  E  K  P         p.24640

          .         .         .         .         .         .       g.263651
 GAGCATGATGGAGGCAGCCGAATTCTAGGCTACATTGTGGAGATGCAGACCAAAGGCAGT       c.73980
 E  H  D  G  G  S  R  I  L  G  Y  I  V  E  M  Q  T  K  G  S         p.24660

          .         .         .         .         .         .       g.263711
 GACAAATGGGCCACGTGTGCCACAGTCAAGGTCACTGAAGCCACTATCACTGGATTAATT       c.74040
 D  K  W  A  T  C  A  T  V  K  V  T  E  A  T  I  T  G  L  I         p.24680

          .         .         .         .         .         .       g.263771
 CAGGGTGAAGAATACTCTTTCCGTGTTTCAGCTCAGAATGAAAAGGGCATCAGTGATCCT       c.74100
 Q  G  E  E  Y  S  F  R  V  S  A  Q  N  E  K  G  I  S  D  P         p.24700

          .         .         .         .         .         .       g.263831
 AGACAACTGAGTGTGCCAGTGATCGCCAAAGATCTTGTCATTCCACCAGCCTTCAAACTC       c.74160
 R  Q  L  S  V  P  V  I  A  K  D  L  V  I  P  P  A  F  K  L         p.24720

          .         .         .         .         .         .       g.263891
 CTGTTCAATACTTTCACTGTACTGGCAGGTGAAGACCTAAAAGTTGATGTTCCATTCATT       c.74220
 L  F  N  T  F  T  V  L  A  G  E  D  L  K  V  D  V  P  F  I         p.24740

          .         .         .         .         .         .       g.263951
 GGCCGCCCTACCCCAGCTGTAACCTGGCATAAAGATAATGTACCACTGAAGCAGACAACT       c.74280
 G  R  P  T  P  A  V  T  W  H  K  D  N  V  P  L  K  Q  T  T         p.24760

          .         .         .         .         .         .       g.264011
 AGAGTAAATGCAGAGAGCACAGAAAATAATTCACTACTGACAATAAAGGACGCCTGCCGA       c.74340
 R  V  N  A  E  S  T  E  N  N  S  L  L  T  I  K  D  A  C  R         p.24780

          .         .         .         .         .         .       g.264071
 GAAGATGTTGGCCATTATGTGGTTAAACTGACTAACTCAGCTGGTGAAGCTATTGAAACC       c.74400
 E  D  V  G  H  Y  V  V  K  L  T  N  S  A  G  E  A  I  E  T         p.24800

          .         .         .         .         .         .       g.264131
 CTTAATGTTATCGTTCTTGACAAACCAGGGCCTCCAACTGGACCAGTTAAAATGGATGAA       c.74460
 L  N  V  I  V  L  D  K  P  G  P  P  T  G  P  V  K  M  D  E         p.24820

          .         .         .         .         .         .       g.264191
 GTGACAGCTGATAGTATTACTCTTTCCTGGGGCCCACCCAAGTATGATGGTGGAAGTTCT       c.74520
 V  T  A  D  S  I  T  L  S  W  G  P  P  K  Y  D  G  G  S  S         p.24840

          .         .         .         .         .         .       g.264251
 ATCAATAATTACATTGTTGAGAAACGGGACACTTCCACAACCACCTGGCAAATTGTATCA       c.74580
 I  N  N  Y  I  V  E  K  R  D  T  S  T  T  T  W  Q  I  V  S         p.24860

          .         .         .         .         .         .       g.264311
 GCTACAGTTGCAAGGACAACAATAAAGGCTTGCAGACTGAAGACTGGATGTGAATATCAG       c.74640
 A  T  V  A  R  T  T  I  K  A  C  R  L  K  T  G  C  E  Y  Q         p.24880

          .         .         .         .         .         .       g.264371
 TTTAGAATTGCAGCTGAAAACAGATATGGGAAGAGTACCTACCTCAATTCAGAGCCTACT       c.74700
 F  R  I  A  A  E  N  R  Y  G  K  S  T  Y  L  N  S  E  P  T         p.24900

          .         .         .         .         .         .       g.264431
 GTAGCCCAATATCCATTCAAAGTTCCTGGTCCTCCTGGCACTCCAGTTGTCACACTGTCC       c.74760
 V  A  Q  Y  P  F  K  V  P  G  P  P  G  T  P  V  V  T  L  S         p.24920

          .         .         .         .         .         .       g.264491
 TCCAGGGACAGCATGGAAGTACAATGGAATGAGCCAATCAGTGATGGAGGAAGTAGAGTC       c.74820
 S  R  D  S  M  E  V  Q  W  N  E  P  I  S  D  G  G  S  R  V         p.24940

          .         .         .         .         .         .       g.264551
 ATTGGCTATCATCTAGAACGCAAGGAAAGAAATAGCATCCTCTGGGTTAAGTTGAATAAA       c.74880
 I  G  Y  H  L  E  R  K  E  R  N  S  I  L  W  V  K  L  N  K         p.24960

          .         .         .         .         .         .       g.264611
 ACACCTATTCCTCAAACCAAGTTTAAGACAACTGGCCTTGAAGAAGGTGTTGAATATGAA       c.74940
 T  P  I  P  Q  T  K  F  K  T  T  G  L  E  E  G  V  E  Y  E         p.24980

          .         .         .         .         .         .       g.264671
 TTTAGAGTCTCTGCAGAGAACATCGTGGGCATTGGCAAGCCGAGTAAAGTATCAGAATGT       c.75000
 F  R  V  S  A  E  N  I  V  G  I  G  K  P  S  K  V  S  E  C         p.25000

          .         .         .         .         .         .       g.264731
 TATGTGGCTCGTGACCCATGTGATCCACCAGGACGGCCAGAGGCAATCATTGTCACAAGG       c.75060
 Y  V  A  R  D  P  C  D  P  P  G  R  P  E  A  I  I  V  T  R         p.25020

          .         .         .         .         .         .       g.264791
 AATTCTGTGACTCTTCAGTGGAAGAAACCCACCTATGACGGTGGAAGCAAGATCACTGGT       c.75120
 N  S  V  T  L  Q  W  K  K  P  T  Y  D  G  G  S  K  I  T  G         p.25040

          .         .         .         .         .         .       g.264851
 TATATTGTTGAGAAGAAAGAATTACCTGAGGGCCGTTGGATGAAAGCCAGTTTTACAAAT       c.75180
 Y  I  V  E  K  K  E  L  P  E  G  R  W  M  K  A  S  F  T  N         p.25060

          .         .         .         .         .         .       g.264911
 ATTATTGACACTCATTTTGAAGTAACTGGCCTAGTTGAAGATCACAGATATGAGTTCCGG       c.75240
 I  I  D  T  H  F  E  V  T  G  L  V  E  D  H  R  Y  E  F  R         p.25080

          .         .         .         .         .         .       g.264971
 GTTATAGCCCGAAATGCCGCAGGAGTGTTTAGTGAGCCTTCAGAAAGCACAGGAGCAATA       c.75300
 V  I  A  R  N  A  A  G  V  F  S  E  P  S  E  S  T  G  A  I         p.25100

          .         .         .         .         .         .       g.265031
 ACAGCTAGAGATGAGGTAGATCCACCACGAATAAGTATGGATCCAAAATACAAAGACACA       c.75360
 T  A  R  D  E  V  D  P  P  R  I  S  M  D  P  K  Y  K  D  T         p.25120

          .         .         .         .         .         .       g.265091
 ATCGTGGTTCATGCTGGTGAATCATTCAAGGTTGATGCAGATATTTATGGCAAACCAATA       c.75420
 I  V  V  H  A  G  E  S  F  K  V  D  A  D  I  Y  G  K  P  I         p.25140

          .         .         .         .         .         .       g.265151
 CCAACCATTCAGTGGATAAAAGGTGATCAGGAGCTTTCAAACACAGCTCGATTAGAAATA       c.75480
 P  T  I  Q  W  I  K  G  D  Q  E  L  S  N  T  A  R  L  E  I         p.25160

          .         .         .         .         .         .       g.265211
 AAGAGCACCGACTTTGCCACCAGTCTCAGTGTAAAAGATGCAGTACGTGTCGACAGTGGA       c.75540
 K  S  T  D  F  A  T  S  L  S  V  K  D  A  V  R  V  D  S  G         p.25180

          .         .         .         .         .         .       g.265271
 AATTACATACTGAAGGCCAAAAATGTTGCAGGAGAAAGATCAGTTACTGTGAATGTCAAG       c.75600
 N  Y  I  L  K  A  K  N  V  A  G  E  R  S  V  T  V  N  V  K         p.25200

          .         .         .         .         .         .       g.265331
 GTTCTTGACAGACCAGGGCCACCTGAAGGACCTGTTGTTATCTCAGGAGTTACAGCAGAA       c.75660
 V  L  D  R  P  G  P  P  E  G  P  V  V  I  S  G  V  T  A  E         p.25220

          .         .         .         .         .         .       g.265391
 AAATGCACACTAGCTTGGAAACCCCCACTTCAGGATGGTGGGAGTGACATCATAAATTAT       c.75720
 K  C  T  L  A  W  K  P  P  L  Q  D  G  G  S  D  I  I  N  Y         p.25240

          .         .         .         .         .         .       g.265451
 ATTGTGGAAAGGAGAGAAACCAGCCGCTTAGTTTGGACTGTGGTTGATGCCAATGTGCAG       c.75780
 I  V  E  R  R  E  T  S  R  L  V  W  T  V  V  D  A  N  V  Q         p.25260

          .         .         .         .         .         .       g.265511
 ACTCTCAGCTGCAAGGTTACTAAGCTTCTTGAAGGCAATGAATATACTTTCCGTATAATG       c.75840
 T  L  S  C  K  V  T  K  L  L  E  G  N  E  Y  T  F  R  I  M         p.25280

          .         .         .         .         .         .       g.265571
 GCAGTAAACAAATATGGTGTTGGTGAACCTCTTGAATCTGAGCCAGTAGTTGCCAAGAAT       c.75900
 A  V  N  K  Y  G  V  G  E  P  L  E  S  E  P  V  V  A  K  N         p.25300

          .         .         .         .         .         .       g.265631
 CCATTTGTAGTACCAGATGCACCAAAAGCTCCAGAAGTCACAACAGTGACCAAGGACTCA       c.75960
 P  F  V  V  P  D  A  P  K  A  P  E  V  T  T  V  T  K  D  S         p.25320

          .         .         .         .         .         .       g.265691
 ATGATTGTTGTATGGGAAAGACCAGCATCTGATGGTGGTAGTGAAATTCTTGGATATGTT       c.76020
 M  I  V  V  W  E  R  P  A  S  D  G  G  S  E  I  L  G  Y  V         p.25340

          .         .         .         .         .         .       g.265751
 CTTGAGAAACGGGATAAAGAAGGCATTAGATGGACAAGATGCCATAAGCGTCTGATTGGA       c.76080
 L  E  K  R  D  K  E  G  I  R  W  T  R  C  H  K  R  L  I  G         p.25360

          .         .         .         .         .         .       g.265811
 GAGTTGCGCCTGAGAGTAACTGGACTCATAGAAAATCACGATTATGAGTTCAGAGTTTCT       c.76140
 E  L  R  L  R  V  T  G  L  I  E  N  H  D  Y  E  F  R  V  S         p.25380

          .         .         .         .         .         .       g.265871
 GCTGAGAATGCTGCTGGACTTAGTGAACCAAGCCCTCCTTCTGCTTACCAAAAGGCTTGT       c.76200
 A  E  N  A  A  G  L  S  E  P  S  P  P  S  A  Y  Q  K  A  C         p.25400

          .         .         .         .         .         .       g.265931
 GATCCTATTTATAAACCAGGACCCCCAAACAACCCCAAAGTCATAGACATAACCAGATCT       c.76260
 D  P  I  Y  K  P  G  P  P  N  N  P  K  V  I  D  I  T  R  S         p.25420

          .         .         .         .         .         .       g.265991
 TCAGTATTCCTTTCTTGGAGCAAACCAATATATGATGGTGGCTGTGAAATTCAAGGATAC       c.76320
 S  V  F  L  S  W  S  K  P  I  Y  D  G  G  C  E  I  Q  G  Y         p.25440

          .         .         .         .         .         .       g.266051
 ATTGTTGAAAAATGTGATGTGAGTGTTGGTGAATGGACAATGTGCACTCCACCAACAGGA       c.76380
 I  V  E  K  C  D  V  S  V  G  E  W  T  M  C  T  P  P  T  G         p.25460

          .         .         .         .         .         .       g.266111
 ATTAATAAAACAAACATAGAAGTAGAGAAGCTGTTGGAAAAGCATGAATACAACTTCCGT       c.76440
 I  N  K  T  N  I  E  V  E  K  L  L  E  K  H  E  Y  N  F  R         p.25480

          .         .         .         .         .         .       g.266171
 ATCTGTGCTATTAATAAAGCTGGAGTTGGAGAACATGCTGACGTCCCTGGACCTATTATA       c.76500
 I  C  A  I  N  K  A  G  V  G  E  H  A  D  V  P  G  P  I  I         p.25500

          .         .         .         .         .         .       g.266231
 GTTGAAGAAAAATTAGAAGCACCAGACATTGATCTTGACCTAGAACTAAGGAAAATCATA       c.76560
 V  E  E  K  L  E  A  P  D  I  D  L  D  L  E  L  R  K  I  I         p.25520

          .         .         .         .         .         .       g.266291
 AATATAAGGGCAGGTGGCTCCTTAAGGTTATTTGTTCCTATAAAAGGTCGTCCTACACCA       c.76620
 N  I  R  A  G  G  S  L  R  L  F  V  P  I  K  G  R  P  T  P         p.25540

          .         .         .         .         .         .       g.266351
 GAAGTTAAATGGGGAAAGGTGGATGGTGAAATCCGAGATGCAGCTATAATTGATGTCACT       c.76680
 E  V  K  W  G  K  V  D  G  E  I  R  D  A  A  I  I  D  V  T         p.25560

          .         .         .         .         .         .       g.266411
 AGCAGTTTCACCTCTCTTGTTCTTGACAATGTCAACCGATATGATAGTGGAAAATATACG       c.76740
 S  S  F  T  S  L  V  L  D  N  V  N  R  Y  D  S  G  K  Y  T         p.25580

          .         .         .         .         .         .       g.266471
 CTTACATTAGAAAACAGCAGTGGAACAAAGTCTGCCTTTGTTACTGTGAGAGTTCTGGAC       c.76800
 L  T  L  E  N  S  S  G  T  K  S  A  F  V  T  V  R  V  L  D         p.25600

          .         .         .         .         .         .       g.266531
 ACGCCAAGTCCACCTGTTAACCTGAAAGTCACAGAAATCACCAAAGACTCAGTATCAATT       c.76860
 T  P  S  P  P  V  N  L  K  V  T  E  I  T  K  D  S  V  S  I         p.25620

          .         .         .         .         .         .       g.266591
 ACATGGGAACCTCCTTTGTTGGATGGGGGATCCAAAATAAAAAATTACATTGTTGAGAAA       c.76920
 T  W  E  P  P  L  L  D  G  G  S  K  I  K  N  Y  I  V  E  K         p.25640

          .         .         .         .         .         .       g.266651
 CGTGAAGCCACAAGAAAATCATATGCTGCTGTTGTAACTAACTGCCATAAGAATTCTTGG       c.76980
 R  E  A  T  R  K  S  Y  A  A  V  V  T  N  C  H  K  N  S  W         p.25660

          .         .         .         .         .         .       g.266711
 AAAATCGATCAGCTCCAAGAAGGTTGCAGTTATTACTTTAGAGTCACAGCTGAGAATGAG       c.77040
 K  I  D  Q  L  Q  E  G  C  S  Y  Y  F  R  V  T  A  E  N  E         p.25680

          .         .         .         .         .         .       g.266771
 TATGGTATTGGCCTTCCTGCCCAGACTGCTGATCCAATTAAGGTTGCAGAAGTGCCACAA       c.77100
 Y  G  I  G  L  P  A  Q  T  A  D  P  I  K  V  A  E  V  P  Q         p.25700

          .         .         .         .         .         .       g.266831
 CCTCCTGGAAAAATAACTGTGGATGATGTCACCAGAAACAGTGTCTCTCTGAGTTGGACA       c.77160
 P  P  G  K  I  T  V  D  D  V  T  R  N  S  V  S  L  S  W  T         p.25720

          .         .         .         .         .         .       g.266891
 AAACCTGAACATGATGGTGGCAGTAAAATCATTCAGTATATTGTGGAAATGCAAGCTAAA       c.77220
 K  P  E  H  D  G  G  S  K  I  I  Q  Y  I  V  E  M  Q  A  K         p.25740

          .         .         .         .         .         .       g.266951
 CACAGTGAGAAATGGTCAGAGTGTGCTCGAGTAAAGTCTCTTCAGGCAGTAATTACCAAC       c.77280
 H  S  E  K  W  S  E  C  A  R  V  K  S  L  Q  A  V  I  T  N         p.25760

          .         .         .         .         .         .       g.267011
 CTAACTCAAGGGGAAGAATATCTTTTTAGAGTTGTTGCTGTAAATGAAAAGGGGAGAAGT       c.77340
 L  T  Q  G  E  E  Y  L  F  R  V  V  A  V  N  E  K  G  R  S         p.25780

          .         .         .         .         .         .       g.267071
 GATCCTCGGTCCCTTGCAGTTCCAATAGTTGCCAAAGATCTGGTAATTGAGCCAGATGTA       c.77400
 D  P  R  S  L  A  V  P  I  V  A  K  D  L  V  I  E  P  D  V         p.25800

          .         .         .         .         .         .       g.267131
 AAACCTGCATTCAGTAGTTACAGTGTACAGGTTGGCCAAGATTTGAAAATAGAAGTGCCA       c.77460
 K  P  A  F  S  S  Y  S  V  Q  V  G  Q  D  L  K  I  E  V  P         p.25820

          .         .         .         .         .         .       g.267191
 ATTTCTGGACGTCCTAAGCCAACCATTACCTGGACTAAAGATGGTCTCCCACTGAAGCAG       c.77520
 I  S  G  R  P  K  P  T  I  T  W  T  K  D  G  L  P  L  K  Q         p.25840

          .         .         .         .         .         .       g.267251
 ACCACAAGAATCAATGTTACCGATTCACTGGATCTCACCACACTCAGTATTAAAGAAACT       c.77580
 T  T  R  I  N  V  T  D  S  L  D  L  T  T  L  S  I  K  E  T         p.25860

          .         .         .         .         .         .       g.267311
 CATAAGGATGATGGTGGACAATATGGAATCACAGTTGCCAATGTTGTTGGTCAGAAGACA       c.77640
 H  K  D  D  G  G  Q  Y  G  I  T  V  A  N  V  V  G  Q  K  T         p.25880

          .         .         .         .         .         .       g.267371
 GCATCCATCGAAATTGTAACTCTAGATAAACCTGATCCTCCAAAAGGACCTGTTAAATTT       c.77700
 A  S  I  E  I  V  T  L  D  K  P  D  P  P  K  G  P  V  K  F         p.25900

          .         .         .         .         .         .       g.267431
 GATGACGTCAGTGCTGAAAGTATTACATTATCTTGGAACCCTCCATTATATACAGGGGGC       c.77760
 D  D  V  S  A  E  S  I  T  L  S  W  N  P  P  L  Y  T  G  G         p.25920

          .         .         .         .         .         .       g.267491
 TGCCAAATCACCAACTACATTGTTCAGAAAAGAGATACAACCACCACAGTATGGGATGTT       c.77820
 C  Q  I  T  N  Y  I  V  Q  K  R  D  T  T  T  T  V  W  D  V         p.25940

          .         .         .         .         .         .       g.267551
 GTTTCTGCTACTGTTGCTAGAACTACACTCAAAGTGACCAAACTGAAAACTGGTACAGAA       c.77880
 V  S  A  T  V  A  R  T  T  L  K  V  T  K  L  K  T  G  T  E         p.25960

          .         .         .         .         .         .       g.267611
 TACCAATTTAGAATATTTGCCGAAAACAGATATGGACAAAGCTTTGCCTTAGAGTCTGAT       c.77940
 Y  Q  F  R  I  F  A  E  N  R  Y  G  Q  S  F  A  L  E  S  D         p.25980

          .         .         .         .         .         .       g.267671
 CCAATTGTAGCTCAATATCCCTACAAAGAACCAGGCCCTCCAGGTACACCATTTGCCACA       c.78000
 P  I  V  A  Q  Y  P  Y  K  E  P  G  P  P  G  T  P  F  A  T         p.26000

          .         .         .         .         .         .       g.267731
 GCCATTTCCAAAGACTCCATGGTCATACAGTGGCATGAACCAGTCAACAATGGTGGAAGC       c.78060
 A  I  S  K  D  S  M  V  I  Q  W  H  E  P  V  N  N  G  G  S         p.26020

          .         .         .         .         .         .       g.267791
 CCCGTCATAGGTTACCACCTGGAGAGAAAAGAAAGAAACAGTATTTTGTGGACAAAGGTC       c.78120
 P  V  I  G  Y  H  L  E  R  K  E  R  N  S  I  L  W  T  K  V         p.26040

          .         .         .         .         .         .       g.267851
 AACAAAACTATTATTCATGACACCCAATTCAAAGCACAGAATCTTGAAGAAGGCATTGAA       c.78180
 N  K  T  I  I  H  D  T  Q  F  K  A  Q  N  L  E  E  G  I  E         p.26060

          .         .         .         .         .         .       g.267911
 TATGAATTCAGAGTGTATGCTGAAAATATTGTTGGTGTAGGCAAAGCAAGCAAGAATTCT       c.78240
 Y  E  F  R  V  Y  A  E  N  I  V  G  V  G  K  A  S  K  N  S         p.26080

          .         .         .         .         .         .       g.267971
 GAATGCTATGTAGCCAGAGATCCCTGTGACCCACCAGGAACCCCAGAACCAATAATGGTT       c.78300
 E  C  Y  V  A  R  D  P  C  D  P  P  G  T  P  E  P  I  M  V         p.26100

          .         .         .         .         .         .       g.268031
 AAAAGAAATGAAATCACTTTACAGTGGACCAAACCTGTGTATGATGGTGGAAGTATGATT       c.78360
 K  R  N  E  I  T  L  Q  W  T  K  P  V  Y  D  G  G  S  M  I         p.26120

          .         .         .         .         .         .       g.268091
 ACAGGCTACATTGTAGAGAAACGTGATTTGCCTGATGGTCGTTGGATGAAAGCTAGCTTT       c.78420
 T  G  Y  I  V  E  K  R  D  L  P  D  G  R  W  M  K  A  S  F         p.26140

          .         .         .         .         .         .       g.268151
 ACAAATGTCATTGAAACTCAATTTACTGTGTCAGGTCTTACTGAAGATCAAAGATATGAA       c.78480
 T  N  V  I  E  T  Q  F  T  V  S  G  L  T  E  D  Q  R  Y  E         p.26160

          .         .         .         .         .         .       g.268211
 TTCAGAGTCATTGCAAAGAATGCAGCTGGTGCAATAAGTAAACCCTCTGACAGTACTGGA       c.78540
 F  R  V  I  A  K  N  A  A  G  A  I  S  K  P  S  D  S  T  G         p.26180

          .         .         .         .         .         .       g.268271
 CCAATAACTGCCAAGGATGAGGTTGAACTCCCAAGAATTTCAATGGATCCAAAATTCAGA       c.78600
 P  I  T  A  K  D  E  V  E  L  P  R  I  S  M  D  P  K  F  R         p.26200

          .         .         .         .         .         .       g.268331
 GACACAATTGTGGTAAATGCTGGAGAAACATTCAGACTTGAGGCTGATGTCCATGGAAAG       c.78660
 D  T  I  V  V  N  A  G  E  T  F  R  L  E  A  D  V  H  G  K         p.26220

          .         .         .         .         .         .       g.268391
 CCCCTACCTACCATTGAGTGGTTAAGAGGAGATAAGGAAATTGAAGAATCTGCTAGATGT       c.78720
 P  L  P  T  I  E  W  L  R  G  D  K  E  I  E  E  S  A  R  C         p.26240

          .         .         .         .         .         .       g.268451
 GAAATAAAGAACACAGATTTCAAGGCTTTACTTATTGTAAAAGATGCAATTAGAATTGAT       c.78780
 E  I  K  N  T  D  F  K  A  L  L  I  V  K  D  A  I  R  I  D         p.26260

          .         .         .         .         .         .       g.268511
 GGTGGGCAGTATATTTTAAGAGCTTCCAATGTTGCAGGTTCTAAGTCATTCCCAGTAAAT       c.78840
 G  G  Q  Y  I  L  R  A  S  N  V  A  G  S  K  S  F  P  V  N         p.26280

          .         .         .         .         .         .       g.268571
 GTAAAAGTATTAGATAGACCAGGACCTCCAGAAGGGCCAGTCCAGGTTACTGGAGTCACT       c.78900
 V  K  V  L  D  R  P  G  P  P  E  G  P  V  Q  V  T  G  V  T         p.26300

          .         .         .         .         .         .       g.268631
 TCTGAAAAATGCTCTTTAACATGGTCTCCACCACTTCAAGATGGTGGCAGTGACATTTCT       c.78960
 S  E  K  C  S  L  T  W  S  P  P  L  Q  D  G  G  S  D  I  S         p.26320

          .         .         .         .         .         .       g.268691
 CACTATGTTGTTGAAAAGCGAGAAACCAGTCGACTTGCCTGGACTGTTGTTGCTTCAGAA       c.79020
 H  Y  V  V  E  K  R  E  T  S  R  L  A  W  T  V  V  A  S  E         p.26340

          .         .         .         .         .         .       g.268751
 GTTGTGACCAATTCTCTGAAAGTTACCAAACTCTTAGAAGGTAATGAATATGTTTTCCGT       c.79080
 V  V  T  N  S  L  K  V  T  K  L  L  E  G  N  E  Y  V  F  R         p.26360

          .         .         .         .         .         .       g.268811
 ATAATGGCTGTCAACAAATATGGTGTTGGAGAGCCTTTGGAATCTGCACCAGTACTAATG       c.79140
 I  M  A  V  N  K  Y  G  V  G  E  P  L  E  S  A  P  V  L  M         p.26380

          .         .         .         .         .         .       g.268871
 AAAAATCCATTTGTGCTTCCTGGACCACCAAAAAGCTTGGAAGTCACAAATATTGCCAAA       c.79200
 K  N  P  F  V  L  P  G  P  P  K  S  L  E  V  T  N  I  A  K         p.26400

          .         .         .         .         .         .       g.268931
 GACTCCATGACCGTCTGTTGGAACCGTCCAGATAGTGATGGTGGAAGTGAGATTATTGGT       c.79260
 D  S  M  T  V  C  W  N  R  P  D  S  D  G  G  S  E  I  I  G         p.26420

          .         .         .         .         .         .       g.268991
 TACATTGTAGAGAAAAGAGACAGAAGTGGCATTCGATGGATAAAATGTAATAAACGCCGC       c.79320
 Y  I  V  E  K  R  D  R  S  G  I  R  W  I  K  C  N  K  R  R         p.26440

          .         .         .         .         .         .       g.269051
 ATTACAGATTTGCGTCTAAGAGTGACAGGATTAACAGAAGATCATGAGTATGAATTCAGG       c.79380
 I  T  D  L  R  L  R  V  T  G  L  T  E  D  H  E  Y  E  F  R         p.26460

          .         .         .         .         .         .       g.269111
 GTCTCTGCAGAAAATGCTGCTGGAGTTGGGGAACCAAGTCCAGCTACAGTTTATTATAAA       c.79440
 V  S  A  E  N  A  A  G  V  G  E  P  S  P  A  T  V  Y  Y  K         p.26480

          .         .         .         .         .         .       g.269171
 GCCTGTGATCCTGTGTTCAAACCTGGCCCACCTACCAATGCACACATTGTAGACACCACT       c.79500
 A  C  D  P  V  F  K  P  G  P  P  T  N  A  H  I  V  D  T  T         p.26500

          .         .         .         .         .         .       g.269231
 AAAAATTCAATCACACTTGCCTGGGGTAAACCCATCTATGATGGCGGCAGTGAGATCTTG       c.79560
 K  N  S  I  T  L  A  W  G  K  P  I  Y  D  G  G  S  E  I  L         p.26520

          .         .         .         .         .         .       g.269291
 GGATATGTAGTAGAAATCTGTAAAGCAGATGAAGAAGAATGGCAAATAGTTACTCCACAG       c.79620
 G  Y  V  V  E  I  C  K  A  D  E  E  E  W  Q  I  V  T  P  Q         p.26540

          .         .         .         .         .         .       g.269351
 ACTGGCCTGAGAGTCACTCGATTTGAAATTTCAAAACTCACTGAACACCAAGAGTATAAA       c.79680
 T  G  L  R  V  T  R  F  E  I  S  K  L  T  E  H  Q  E  Y  K         p.26560

          .         .         .         .         .         .       g.269411
 ATACGAGTCTGTGCCCTCAACAAAGTTGGTTTAGGTGAGGCTACATCAGTTCCTGGTACT       c.79740
 I  R  V  C  A  L  N  K  V  G  L  G  E  A  T  S  V  P  G  T         p.26580

          .         .         .         .         .         .       g.269471
 GTGAAACCAGAAGATAAACTTGAAGCACCTGAACTTGACCTTGACTCCGAATTAAGAAAA       c.79800
 V  K  P  E  D  K  L  E  A  P  E  L  D  L  D  S  E  L  R  K         p.26600

          .         .         .         .         .         .       g.269531
 GGAATTGTTGTAAGAGCTGGTGGATCTGCCAGAATTCACATTCCATTCAAAGGTCGTCCA       c.79860
 G  I  V  V  R  A  G  G  S  A  R  I  H  I  P  F  K  G  R  P         p.26620

          .         .         .         .         .         .       g.269591
 ACGCCTGAGATCACTTGGTCTCGAGAGGAAGGTGAATTCACAGATAAGGTCCAAATTGAA       c.79920
 T  P  E  I  T  W  S  R  E  E  G  E  F  T  D  K  V  Q  I  E         p.26640

          .         .         .         .         .         .       g.269651
 AAGGGAGTAAACTATACCCAACTATCAATAGATAACTGTGATAGAAATGATGCTGGAAAA       c.79980
 K  G  V  N  Y  T  Q  L  S  I  D  N  C  D  R  N  D  A  G  K         p.26660

          .         .         .         .         .         .       g.269711
 TACATTCTTAAGTTGGAAAACAGCAGTGGATCAAAGTCTGCTTTTGTAACTGTGAAAGTT       c.80040
 Y  I  L  K  L  E  N  S  S  G  S  K  S  A  F  V  T  V  K  V         p.26680

          .         .         .         .         .         .       g.269771
 CTTGACACTCCAGGACCACCACAGAATTTGGCAGTCAAAGAAGTGAGAAAAGATTCTGCC       c.80100
 L  D  T  P  G  P  P  Q  N  L  A  V  K  E  V  R  K  D  S  A         p.26700

          .         .         .         .         .         .       g.269831
 TTCCTGGTATGGGAGCCACCCATCATTGATGGAGGGGCAAAGGTCAAGAACTATGTGATT       c.80160
 F  L  V  W  E  P  P  I  I  D  G  G  A  K  V  K  N  Y  V  I         p.26720

          .         .         .         .         .         .       g.269891
 GACAAACGTGAGTCAACCAGAAAAGCGTATGCTAATGTGAGTAGTAAATGCAGCAAAACA       c.80220
 D  K  R  E  S  T  R  K  A  Y  A  N  V  S  S  K  C  S  K  T         p.26740

          .         .         .         .         .         .       g.269951
 AGTTTTAAAGTGGAAAACCTTACAGAAGGAGCCATTTATTACTTCAGAGTCATGGCTGAA       c.80280
 S  F  K  V  E  N  L  T  E  G  A  I  Y  Y  F  R  V  M  A  E         p.26760

          .         .         .         .         .         .       g.270011
 AATGAATTTGGAGTTGGTGTTCCAGTGGAAACTGTTGATGCCGTGAAAGCTGCTGAACCT       c.80340
 N  E  F  G  V  G  V  P  V  E  T  V  D  A  V  K  A  A  E  P         p.26780

          .         .         .         .         .         .       g.270071
 CCTTCCCCACCAGGAAAGGTTACACTCACTGATGTGTCCCAGACCAGTGCATCACTTATG       c.80400
 P  S  P  P  G  K  V  T  L  T  D  V  S  Q  T  S  A  S  L  M         p.26800

          .         .         .         .         .         .       g.270131
 TGGGAGAAACCTGAACATGATGGCGGTAGCAGAGTCCTGGGGTACGTTGTTGAAATGCAG       c.80460
 W  E  K  P  E  H  D  G  G  S  R  V  L  G  Y  V  V  E  M  Q         p.26820

          .         .         .         .         .         .       g.270191
 CCCAAAGGAACTGAAAAATGGAGCATTGTGGCTGAATCCAAAGTCTGTAATGCAGTTGTT       c.80520
 P  K  G  T  E  K  W  S  I  V  A  E  S  K  V  C  N  A  V  V         p.26840

          .         .         .         .         .         .       g.270251
 ACTGGTTTGAGTTCTGGACAAGAATATCAGTTCCGTGTCAAGGCTTATAATGAGAAAGGA       c.80580
 T  G  L  S  S  G  Q  E  Y  Q  F  R  V  K  A  Y  N  E  K  G         p.26860

          .         .         .         .         .         .       g.270311
 AAAAGCGATCCAAGAGTGTTGGGTGTTCCTGTCATAGCCAAGGACTTGACTATACAGCCT       c.80640
 K  S  D  P  R  V  L  G  V  P  V  I  A  K  D  L  T  I  Q  P         p.26880

          .         .         .         .         .         .       g.270371
 AGTTTAAAGTTACCATTTAACACATATAGTATCCAAGCTGGAGAAGATCTTAAAATAGAA       c.80700
 S  L  K  L  P  F  N  T  Y  S  I  Q  A  G  E  D  L  K  I  E         p.26900

          .         .         .         .         .         .       g.270431
 ATTCCAGTTATAGGCCGACCAAGACCTAACATTTCTTGGGTCAAAGATGGTGAGCCTCTT       c.80760
 I  P  V  I  G  R  P  R  P  N  I  S  W  V  K  D  G  E  P  L         p.26920

          .         .         .         .         .         .       g.270491
 AAACAGACAACAAGAGTAAACGTTGAAGAAACAGCTACCTCAACTGTTTTGCACATTAAA       c.80820
 K  Q  T  T  R  V  N  V  E  E  T  A  T  S  T  V  L  H  I  K         p.26940

          .         .         .         .         .         .       g.270551
 GAAGGTAACAAAGATGACTTTGGAAAATACACCGTAACGGCAACAAATAGTGCAGGCACA       c.80880
 E  G  N  K  D  D  F  G  K  Y  T  V  T  A  T  N  S  A  G  T         p.26960

          .         .         .         .         .         .       g.270611
 GCAACAGAAAATCTCAGTGTTATCGTTTTAGAAAAGCCTGGACCTCCAGTTGGCCCAGTT       c.80940
 A  T  E  N  L  S  V  I  V  L  E  K  P  G  P  P  V  G  P  V         p.26980

          .         .         .         .         .         .       g.270671
 CGGTTTGATGAAGTTAGTGCAGACTTTGTAGTCATATCTTGGGAACCTCCAGCCTATACT       c.81000
 R  F  D  E  V  S  A  D  F  V  V  I  S  W  E  P  P  A  Y  T         p.27000

          .         .         .         .         .         .       g.270731
 GGTGGCTGCCAAATAAGCAACTACATTGTAGAGAAGCGAGATACAACCACCACCACTTGG       c.81060
 G  G  C  Q  I  S  N  Y  I  V  E  K  R  D  T  T  T  T  T  W         p.27020

          .         .         .         .         .         .       g.270791
 CACATGGTATCAGCAACAGTTGCAAGAACAACAATTAAAATAACCAAACTGAAAACAGGC       c.81120
 H  M  V  S  A  T  V  A  R  T  T  I  K  I  T  K  L  K  T  G         p.27040

          .         .         .         .         .         .       g.270851
 ACGGAGTACCAGTTTAGAATTTTTGCTGAAAACAGGTATGGAAAAAGTGCCCCACTGGAT       c.81180
 T  E  Y  Q  F  R  I  F  A  E  N  R  Y  G  K  S  A  P  L  D         p.27060

          .         .         .         .         .         .       g.270911
 TCTAAGGCAGTTATTGTACAATATCCATTTAAAGAACCTGGACCACCTGGAACTCCTTTT       c.81240
 S  K  A  V  I  V  Q  Y  P  F  K  E  P  G  P  P  G  T  P  F         p.27080

          .         .         .         .         .         .       g.270971
 GTGACATCAATCTCAAAAGATCAGATGCTTGTGCAATGGCATGAGCCAGTGAATGATGGA       c.81300
 V  T  S  I  S  K  D  Q  M  L  V  Q  W  H  E  P  V  N  D  G         p.27100

          .         .         .         .         .         .       g.271031
 GGCACCAAAATTATTGGCTACCATCTTGAACAGAAAGAAAAGAACAGTATTTTATGGGTC       c.81360
 G  T  K  I  I  G  Y  H  L  E  Q  K  E  K  N  S  I  L  W  V         p.27120

          .         .         .         .         .         .       g.271091
 AAGTTAAATAAGACCCCCATTCAGGACACCAAATTCAAAACAACTGGGCTTGATGAGGGC       c.81420
 K  L  N  K  T  P  I  Q  D  T  K  F  K  T  T  G  L  D  E  G         p.27140

          .         .         .         .         .         .       g.271151
 CTTGAGTATGAGTTCAAAGTTTCTGCTGAAAATATTGTTGGCATTGGCAAGCCTAGCAAA       c.81480
 L  E  Y  E  F  K  V  S  A  E  N  I  V  G  I  G  K  P  S  K         p.27160

          .         .         .         .         .         .       g.271211
 GTGTCAGAATGCTTTGTTGCTCGTGATCCATGTGACCCACCTGGTCGCCCTGAAGCCATT       c.81540
 V  S  E  C  F  V  A  R  D  P  C  D  P  P  G  R  P  E  A  I         p.27180

          .         .         .         .         .         .       g.271271
 GTTATTACAAGAAACAATGTCACACTGAAATGGAAGAAACCTGCCTATGATGGTGGTAGC       c.81600
 V  I  T  R  N  N  V  T  L  K  W  K  K  P  A  Y  D  G  G  S         p.27200

          .         .         .         .         .         .       g.271331
 AAAATAACAGGTTATATTGTAGAAAAGAAAGATCTACCTGATGGCCGCTGGATGAAAGCC       c.81660
 K  I  T  G  Y  I  V  E  K  K  D  L  P  D  G  R  W  M  K  A         p.27220

          .         .         .         .         .         .       g.271391
 AGCTTTACCAACGTATTAGAAACTGAATTTACAGTGAGTGGACTTGTAGAAGACCAAAGA       c.81720
 S  F  T  N  V  L  E  T  E  F  T  V  S  G  L  V  E  D  Q  R         p.27240

          .         .         .         .         .         .       g.271451
 TATGAATTTAGAGTAATTGCAAGAAATGCAGCTGGAAACTTTAGTGAACCATCTGATAGT       c.81780
 Y  E  F  R  V  I  A  R  N  A  A  G  N  F  S  E  P  S  D  S         p.27260

          .         .         .         .         .         .       g.271511
 AGTGGTGCCATTACTGCAAGAGATGAAATTGATGCACCAAATGCCTCTCTGGATCCAAAA       c.81840
 S  G  A  I  T  A  R  D  E  I  D  A  P  N  A  S  L  D  P  K         p.27280

          .         .         .         .         .         .       g.271571
 TATAAAGATGTCATCGTTGTTCATGCAGGAGAGACTTTTGTTCTTGAAGCCGACATCCGT       c.81900
 Y  K  D  V  I  V  V  H  A  G  E  T  F  V  L  E  A  D  I  R         p.27300

          .         .         .         .         .         .       g.271631
 GGCAAACCTATACCTGATGTTGTTTGGTCAAAAGATGGAAAAGAACTTGAAGAAACAGCT       c.81960
 G  K  P  I  P  D  V  V  W  S  K  D  G  K  E  L  E  E  T  A         p.27320

          .         .         .         .         .         .       g.271691
 GCTAGAATGGAAATTAAATCTACTATTCAGAAAACAACTCTTGTTGTCAAAGACTGTATA       c.82020
 A  R  M  E  I  K  S  T  I  Q  K  T  T  L  V  V  K  D  C  I         p.27340

          .         .         .         .         .         .       g.271751
 CGGACTGATGGAGGACAATATATTCTGAAACTCAGCAATGTTGGTGGTACAAAGTCTATA       c.82080
 R  T  D  G  G  Q  Y  I  L  K  L  S  N  V  G  G  T  K  S  I         p.27360

          .         .         .         .         .         .       g.271811
 CCCATCACTGTAAAGGTACTTGACAGGCCAGGGCCTCCTGAAGGGCCTCTGAAAGTTACT       c.82140
 P  I  T  V  K  V  L  D  R  P  G  P  P  E  G  P  L  K  V  T         p.27380

          .         .         .         .         .         .       g.271871
 GGAGTTACTGCGGAAAAATGTTACCTGGCATGGAACCCACCTTTGCAAGATGGTGGTGCT       c.82200
 G  V  T  A  E  K  C  Y  L  A  W  N  P  P  L  Q  D  G  G  A         p.27400

          .         .         .         .         .         .       g.271931
 AATATTTCACATTACATCATTGAAAAGAGGGAGACAAGCCGACTCTCTTGGACCCAGGTT       c.82260
 N  I  S  H  Y  I  I  E  K  R  E  T  S  R  L  S  W  T  Q  V         p.27420

          .         .         .         .         .         .       g.271991
 TCAACTGAGGTACAGGCCCTTAACTACAAAGTTACTAAACTTCTTCCTGGTAATGAGTAC       c.82320
 S  T  E  V  Q  A  L  N  Y  K  V  T  K  L  L  P  G  N  E  Y         p.27440

          .         .         .         .         .         .       g.272051
 ATTTTCCGTGTCATGGCTGTGAATAAATATGGAATTGGAGAGCCCTTGGAATCTGGGCCT       c.82380
 I  F  R  V  M  A  V  N  K  Y  G  I  G  E  P  L  E  S  G  P         p.27460

          .         .         .         .         .         .       g.272111
 GTTACGGCCTGTAATCCTTATAAGCCACCAGGTCCTCCCTCAACACCTGAAGTCTCAGCA       c.82440
 V  T  A  C  N  P  Y  K  P  P  G  P  P  S  T  P  E  V  S  A         p.27480

          .         .         .         .         .         .       g.272171
 ATCACCAAAGATTCTATGGTAGTAACATGGGCACGCCCAGTAGACGACGGAGGTACCGAA       c.82500
 I  T  K  D  S  M  V  V  T  W  A  R  P  V  D  D  G  G  T  E         p.27500

          .         .         .         .         .         .       g.272231
 ATTGAGGGCTACATTCTTGAAAAACGAGATAAGGAAGGCGTTAGATGGACCAAGTGCAAC       c.82560
 I  E  G  Y  I  L  E  K  R  D  K  E  G  V  R  W  T  K  C  N         p.27520

          .         .         .         .         .         .       g.272291
 AAGAAAACATTAACGGATCTGCGGCTCAGGGTAACTGGTCTTACCGAAGGCCATTCCTAT       c.82620
 K  K  T  L  T  D  L  R  L  R  V  T  G  L  T  E  G  H  S  Y         p.27540

          .         .         .         .         .         .       g.272351
 GAATTCAGAGTTGCTGCTGAAAATGCAGCTGGTGTGGGAGAACCTAGTGAGCCATCTGTT       c.82680
 E  F  R  V  A  A  E  N  A  A  G  V  G  E  P  S  E  P  S  V         p.27560

          .         .         .         .         .         .       g.272411
 TTCTACCGTGCGTGTGATGCCTTGTATCCACCAGGTCCCCCAAGCAATCCAAAAGTGACG       c.82740
 F  Y  R  A  C  D  A  L  Y  P  P  G  P  P  S  N  P  K  V  T         p.27580

          .         .         .         .         .         .       g.272471
 GACACTTCCAGATCTTCTGTCTCCCTGGCATGGAGTAAGCCAATTTATGATGGTGGCGCA       c.82800
 D  T  S  R  S  S  V  S  L  A  W  S  K  P  I  Y  D  G  G  A         p.27600

          .         .         .         .         .         .       g.272531
 CCTGTTAAAGGCTATGTTGTAGAGGTCAAAGAAGCTGCTGCGGATGAATGGACAACCTGC       c.82860
 P  V  K  G  Y  V  V  E  V  K  E  A  A  A  D  E  W  T  T  C         p.27620

          .         .         .         .         .         .       g.272591
 ACTCCACCAACAGGATTACAAGGAAAGCAGTTCACAGTGACCAAGCTTAAAGAAAACACT       c.82920
 T  P  P  T  G  L  Q  G  K  Q  F  T  V  T  K  L  K  E  N  T         p.27640

          .         .         .         .         .         .       g.272651
 GAATATAACTTCCGTATTTGTGCCATCAATTCTGAAGGTGTAGGTGAACCTGCAACTCTA       c.82980
 E  Y  N  F  R  I  C  A  I  N  S  E  G  V  G  E  P  A  T  L         p.27660

          .         .         .         .         .         .       g.272711
 CCTGGCTCAGTGGTTGCTCAGGAGAGGATAGAGCCACCAGAAATAGAACTCGATGCTGAT       c.83040
 P  G  S  V  V  A  Q  E  R  I  E  P  P  E  I  E  L  D  A  D         p.27680

          .         .         .         .         .         .       g.272771
 CTCAGAAAGGTGGTCGTTCTGCGTGCAAGTGCTACTTTACGCTTATTTGTCACTATCAAA       c.83100
 L  R  K  V  V  V  L  R  A  S  A  T  L  R  L  F  V  T  I  K         p.27700

          .         .         .         .         .         .       g.272831
 GGTCGACCAGAACCCGAAGTTAAATGGGAAAAGGCAGAAGGCATTCTCACTGACAGGGCT       c.83160
 G  R  P  E  P  E  V  K  W  E  K  A  E  G  I  L  T  D  R  A         p.27720

          .         .         .         .         .         .       g.272891
 CAGATAGAGGTGACCAGCTCATTTACAATGTTGGTGATTGATAATGTTACCAGATTTGAC       c.83220
 Q  I  E  V  T  S  S  F  T  M  L  V  I  D  N  V  T  R  F  D         p.27740

          .         .         .         .         .         .       g.272951
 AGTGGTCGGTATAATCTGACATTAGAAAATAATAGTGGCTCCAAAACAGCTTTTGTTAAC       c.83280
 S  G  R  Y  N  L  T  L  E  N  N  S  G  S  K  T  A  F  V  N         p.27760

          .         .         .         .         .         .       g.273011
 GTCAGAGTTCTTGACTCACCAAGTGCCCCTGTGAATTTGACCATAAGAGAAGTGAAGAAA       c.83340
 V  R  V  L  D  S  P  S  A  P  V  N  L  T  I  R  E  V  K  K         p.27780

          .         .         .         .         .         .       g.273071
 GACTCAGTGACGTTGTCCTGGGAACCACCACTTATTGATGGTGGAGCTAAGATTACAAAC       c.83400
 D  S  V  T  L  S  W  E  P  P  L  I  D  G  G  A  K  I  T  N         p.27800

          .         .         .         .         .         .       g.273131
 TACATTGTCGAAAAACGAGAAACTACAAGAAAAGCCTATGCTACCATTACAAATAATTGC       c.83460
 Y  I  V  E  K  R  E  T  T  R  K  A  Y  A  T  I  T  N  N  C         p.27820

          .         .         .         .         .         .       g.273191
 ACTAAAACTACTTTCAGAATTGAAAATCTACAAGAAGGATGTTCTTACTACTTCCGAGTC       c.83520
 T  K  T  T  F  R  I  E  N  L  Q  E  G  C  S  Y  Y  F  R  V         p.27840

          .         .         .         .         .         .       g.273251
 TTGGCTTCCAATGAATATGGGATTGGTTTGCCAGCTGAAACAACAGAACCCGTTAAAGTG       c.83580
 L  A  S  N  E  Y  G  I  G  L  P  A  E  T  T  E  P  V  K  V         p.27860

          .         .         .         .         .         .       g.273311
 TCTGAACCACCCCTCCCACCTGGAAGAGTAACTCTTGTTGATGTGACCCGTAATACAGCT       c.83640
 S  E  P  P  L  P  P  G  R  V  T  L  V  D  V  T  R  N  T  A         p.27880

          .         .         .         .         .         .       g.273371
 ACAATTAAGTGGGAGAAACCAGAAAGTGATGGTGGCAGCAAAATTACTGGTTATGTGGTT       c.83700
 T  I  K  W  E  K  P  E  S  D  G  G  S  K  I  T  G  Y  V  V         p.27900

          .         .         .         .         .         .       g.273431
 GAAATGCAGACTAAAGGGAGTGAAAAGTGGAGCACCTGCACACAAGTTAAGACTCTAGAA       c.83760
 E  M  Q  T  K  G  S  E  K  W  S  T  C  T  Q  V  K  T  L  E         p.27920

          .         .         .         .         .         .       g.273491
 GCAACTATATCTGGCTTAACTGCAGGAGAAGAGTATGTCTTCAGGGTAGCTGCAGTTAAC       c.83820
 A  T  I  S  G  L  T  A  G  E  E  Y  V  F  R  V  A  A  V  N         p.27940

          .         .         .         .         .         .       g.273551
 GAAAAGGGAAGAAGTGATCCAAGACAACTTGGAGTGCCAGTAATTGCAAGGGATATTGAA       c.83880
 E  K  G  R  S  D  P  R  Q  L  G  V  P  V  I  A  R  D  I  E         p.27960

          .         .         .         .         .         .       g.273611
 ATAAAGCCTTCAGTTGAGCTTCCTTTCCATACTTTCAATGTAAAGGCTAGAGAACAACTT       c.83940
 I  K  P  S  V  E  L  P  F  H  T  F  N  V  K  A  R  E  Q  L         p.27980

          .         .         .         .         .         .       g.273671
 AAGATTGATGTGCCATTCAAAGGAAGACCTCAAGCTACTGTGAACTGGAGAAAAGATGGT       c.84000
 K  I  D  V  P  F  K  G  R  P  Q  A  T  V  N  W  R  K  D  G         p.28000

          .         .         .         .         .         .       g.273731
 CAGACTCTTAAAGAGACAACTAGAGTCAATGTTTCTTCTTCAAAGACTGTAACATCACTA       c.84060
 Q  T  L  K  E  T  T  R  V  N  V  S  S  S  K  T  V  T  S  L         p.28020

          .         .         .         .         .         .       g.273791
 TCTATTAAGGAAGCTTCAAAGGAAGATGTTGGAACTTATGAATTATGTGTTTCAAACAGT       c.84120
 S  I  K  E  A  S  K  E  D  V  G  T  Y  E  L  C  V  S  N  S         p.28040

          .         .         .         .         .         .       g.273851
 GCTGGATCCATAACAGTTCCTATTACTATAATTGTCCTTGACAGACCAGGACCTCCAGGT       c.84180
 A  G  S  I  T  V  P  I  T  I  I  V  L  D  R  P  G  P  P  G         p.28060

          .         .         .         .         .         .       g.273911
 CCTATACGTATTGATGAGGTTAGTTGTGACAGCATAACCATTTCTTGGAATCCTCCAGAA       c.84240
 P  I  R  I  D  E  V  S  C  D  S  I  T  I  S  W  N  P  P  E         p.28080

          .         .         .         .         .         .       g.273971
 TATGATGGTGGCTGCCAAATTAGCAATTACATTGTTGAAAAGAAAGAAACCACCTCTACA       c.84300
 Y  D  G  G  C  Q  I  S  N  Y  I  V  E  K  K  E  T  T  S  T         p.28100

          .         .         .         .         .         .       g.274031
 ACATGGCACATAGTTTCACAAGCAGTTGCAAGAACATCCATTAAAATAGTTCGCCTGACA       c.84360
 T  W  H  I  V  S  Q  A  V  A  R  T  S  I  K  I  V  R  L  T         p.28120

          .         .         .         .         .         .       g.274091
 ACAGGAAGTGAGTATCAGTTCCGTGTTTGTGCAGAAAACCGCTATGGAAAGAGCTCCTAC       c.84420
 T  G  S  E  Y  Q  F  R  V  C  A  E  N  R  Y  G  K  S  S  Y         p.28140

          .         .         .         .         .         .       g.274151
 AGTGAATCTTCAGCTGTTGTTGCAGAGTATCCATTCAGTCCCCCAGGTCCTCCTGGTACT       c.84480
 S  E  S  S  A  V  V  A  E  Y  P  F  S  P  P  G  P  P  G  T         p.28160

          .         .         .         .         .         .       g.274211
 CCTAAAGTTGTGCATGCCACAAAATCTACCATGCTTGTAACCTGGCAAGTGCCAGTTAAT       c.84540
 P  K  V  V  H  A  T  K  S  T  M  L  V  T  W  Q  V  P  V  N         p.28180

          .         .         .         .         .         .       g.274271
 GATGGAGGAAGTCGAGTAATTGGCTATCATCTTGAGTATAAAGAAAGAAGCAGCATTCTT       c.84600
 D  G  G  S  R  V  I  G  Y  H  L  E  Y  K  E  R  S  S  I  L         p.28200

          .         .         .         .         .         .       g.274331
 TGGTCAAAAGCAAATAAAATCCTCATTGCTGATACTCAAATGAAAGTCTCCGGCCTTGAT       c.84660
 W  S  K  A  N  K  I  L  I  A  D  T  Q  M  K  V  S  G  L  D         p.28220

          .         .         .         .         .         .       g.274391
 GAAGGACTGATGTATGAGTATCGTGTATATGCTGAAAATATTGCTGGAATTGGTAAATGC       c.84720
 E  G  L  M  Y  E  Y  R  V  Y  A  E  N  I  A  G  I  G  K  C         p.28240

          .         .         .         .         .         .       g.274451
 AGTAAATCTTGTGAACCAGTCCCTGCAAGAGATCCTTGTGACCCTCCTGGACAACCTGAA       c.84780
 S  K  S  C  E  P  V  P  A  R  D  P  C  D  P  P  G  Q  P  E         p.28260

          .         .         .         .         .         .       g.274511
 GTCACAAATATCACAAGAAAATCAGTGTCACTTAAATGGTCTAAACCACATTATGATGGT       c.84840
 V  T  N  I  T  R  K  S  V  S  L  K  W  S  K  P  H  Y  D  G         p.28280

          .         .         .         .         .         .       g.274571
 GGAGCTAAGATCACAGGATACATTGTTGAACGCAGAGAACTACCAGATGGCCGGTGGCTG       c.84900
 G  A  K  I  T  G  Y  I  V  E  R  R  E  L  P  D  G  R  W  L         p.28300

          .         .         .         .         .         .       g.274631
 AAGTGCAATTATACTAATATACAAGAAACATACTTTGAAGTAACTGAACTTACTGAAGAT       c.84960
 K  C  N  Y  T  N  I  Q  E  T  Y  F  E  V  T  E  L  T  E  D         p.28320

          .         .         .         .         .         .       g.274691
 CAGCGTTATGAATTCCGGGTTTTTGCAAGGAATGCTGCTGACTCAGTTAGTGAGCCATCT       c.85020
 Q  R  Y  E  F  R  V  F  A  R  N  A  A  D  S  V  S  E  P  S         p.28340

          .         .         .         .         .         .       g.274751
 GAATCCACTGGGCCTATTATAGTTAAAGATGATGTTGAGCCTCCAAGAGTTATGATGGAT       c.85080
 E  S  T  G  P  I  I  V  K  D  D  V  E  P  P  R  V  M  M  D         p.28360

          .         .         .         .         .         .       g.274811
 GTCAAGTTCCGAGACGTTATTGTTGTCAAAGCTGGAGAGGTCCTTAAGATAAATGCAGAC       c.85140
 V  K  F  R  D  V  I  V  V  K  A  G  E  V  L  K  I  N  A  D         p.28380

          .         .         .         .         .         .       g.274871
 ATTGCAGGGCGACCTCTGCCAGTAATTTCCTGGGCCAAGGATGGTATAGAAATTGAAGAA       c.85200
 I  A  G  R  P  L  P  V  I  S  W  A  K  D  G  I  E  I  E  E         p.28400

          .         .         .         .         .         .       g.274931
 AGAGCAAGAACAGAAATCATCTCAACAGACAATCATACTTTGTTAACAGTTAAAGACTGT       c.85260
 R  A  R  T  E  I  I  S  T  D  N  H  T  L  L  T  V  K  D  C         p.28420

          .         .         .         .         .         .       g.274991
 ATAAGACGAGACACTGGGCAATATGTACTAACACTGAAGAATGTTGCCGGCACTCGGTCT       c.85320
 I  R  R  D  T  G  Q  Y  V  L  T  L  K  N  V  A  G  T  R  S         p.28440

          .         .         .         .         .         .       g.275051
 GTGGCCGTTAATTGCAAAGTACTTGATAAGCCTGGTCCACCAGCAGGACCACTTGAAATA       c.85380
 V  A  V  N  C  K  V  L  D  K  P  G  P  P  A  G  P  L  E  I         p.28460

          .         .         .         .         .         .       g.275111
 AATGGCCTCACTGCTGAGAAATGCTCTCTTTCCTGGGGACGTCCCCAAGAAGATGGTGGT       c.85440
 N  G  L  T  A  E  K  C  S  L  S  W  G  R  P  Q  E  D  G  G         p.28480

          .         .         .         .         .         .       g.275171
 GCAGATATCGACTATTACATCGTAGAAAAACGTGAAACAAGCCACCTTGCATGGACAATA       c.85500
 A  D  I  D  Y  Y  I  V  E  K  R  E  T  S  H  L  A  W  T  I         p.28500

          .         .         .         .         .         .       g.275231
 TGTGAAGGAGAGTTACAGATGACATCCTGTAAAGTAACCAAGTTACTCAAAGGCAATGAA       c.85560
 C  E  G  E  L  Q  M  T  S  C  K  V  T  K  L  L  K  G  N  E         p.28520

          .         .         .         .         .         .       g.275291
 TATATATTTAGAGTAACTGGTGTTAATAAATATGGTGTTGGTGAGCCCCTAGAGAGTGTA       c.85620
 Y  I  F  R  V  T  G  V  N  K  Y  G  V  G  E  P  L  E  S  V         p.28540

          .         .         .         .         .         .       g.275351
 GCTATAAAGGCACTAGATCCATTTACAGTTCCAAGTCCACCCACGTCTTTGGAAATTACT       c.85680
 A  I  K  A  L  D  P  F  T  V  P  S  P  P  T  S  L  E  I  T         p.28560

          .         .         .         .         .         .       g.275411
 TCTGTGACCAAAGAATCTATGACACTTTGCTGGTCAAGACCCGAGAGTGATGGAGGTAGT       c.85740
 S  V  T  K  E  S  M  T  L  C  W  S  R  P  E  S  D  G  G  S         p.28580

          .         .         .         .         .         .       g.275471
 GAAATATCTGGATATATAATTGAAAGGCGAGAGAAAAATAGCCTAAGATGGGTGCGTGTA       c.85800
 E  I  S  G  Y  I  I  E  R  R  E  K  N  S  L  R  W  V  R  V         p.28600

          .         .         .         .         .         .       g.275531
 AACAAAAAACCAGTTTATGATCTAAGAGTGAAATCAACAGGACTTCGGGAAGGATGTGAA       c.85860
 N  K  K  P  V  Y  D  L  R  V  K  S  T  G  L  R  E  G  C  E         p.28620

          .         .         .         .         .         .       g.275591
 TATGAATATCGTGTTTATGCAGAAAATGCTGCTGGCCTAAGTCTTCCAAGTGAAACCTCT       c.85920
 Y  E  Y  R  V  Y  A  E  N  A  A  G  L  S  L  P  S  E  T  S         p.28640

          .         .         .         .         .         .       g.275651
 CCCTTAATTAGGGCAGAAGATCCAGTGTTCCTACCATCTCCTCCATCCAAACCCAAAATT       c.85980
 P  L  I  R  A  E  D  P  V  F  L  P  S  P  P  S  K  P  K  I         p.28660

          .         .         .         .         .         .       g.275711
 GTGGACTCAGGCAAGACAACTATAACTATTGCCTGGGTTAAGCCGCTGTTTGATGGTGGG       c.86040
 V  D  S  G  K  T  T  I  T  I  A  W  V  K  P  L  F  D  G  G         p.28680

          .         .         .         .         .         .       g.275771
 GCCCCGATAACTGGATATACTGTAGAATACAAAAAATCTGATGACACTGACTGGAAAACT       c.86100
 A  P  I  T  G  Y  T  V  E  Y  K  K  S  D  D  T  D  W  K  T         p.28700

          .         .         .         .         .         .       g.275831
 TCCATTCAGAGCTTACGAGGGACAGAATATACAATAAGCGGACTAACAACAGGAGCTGAA       c.86160
 S  I  Q  S  L  R  G  T  E  Y  T  I  S  G  L  T  T  G  A  E         p.28720

          .         .         .         .         .         .       g.275891
 TATGTTTTCAGAGTAAAATCTGTCAATAAGGTTGGTGCTAGTGACCCCAGTGATAGCTCT       c.86220
 Y  V  F  R  V  K  S  V  N  K  V  G  A  S  D  P  S  D  S  S         p.28740

          .         .         .         .         .         .       g.275951
 GACCCTCAGATAGCAAAGGAAAGAGAAGAAGAACCTTTATTTGATATTGACAGTGAAATG       c.86280
 D  P  Q  I  A  K  E  R  E  E  E  P  L  F  D  I  D  S  E  M         p.28760

          .         .         .         .         .         .       g.276011
 AGGAAGACCTTGATTGTCAAGGCTGGTGCCTCATTTACCATGACTGTGCCTTTCCGAGGA       c.86340
 R  K  T  L  I  V  K  A  G  A  S  F  T  M  T  V  P  F  R  G         p.28780

          .         .         .         .         .         .       g.276071
 AGACCAGTACCCAATGTCTTGTGGAGTAAGCCAGACACTGACCTCCGTACTAGAGCTTAT       c.86400
 R  P  V  P  N  V  L  W  S  K  P  D  T  D  L  R  T  R  A  Y         p.28800

          .         .         .         .         .         .       g.276131
 GTTGATACCACAGACTCTCGTACATCACTGACCATTGAAAATGCCAACAGAAATGACTCT       c.86460
 V  D  T  T  D  S  R  T  S  L  T  I  E  N  A  N  R  N  D  S         p.28820

          .         .         .         .         .         .       g.276191
 GGAAAGTACACATTAACAATTCAGAATGTTTTGAGTGCTGCTTCACTGACCTTAGTTGTC       c.86520
 G  K  Y  T  L  T  I  Q  N  V  L  S  A  A  S  L  T  L  V  V         p.28840

          .         .         .         .         .         .       g.276251
 AAAGTTTTAGATACCCCAGGTCCTCCAACCAACATTACTGTGCAAGATGTAACCAAAGAG       c.86580
 K  V  L  D  T  P  G  P  P  T  N  I  T  V  Q  D  V  T  K  E         p.28860

          .         .         .         .         .         .       g.276311
 TCTGCAGTGTTATCCTGGGATGTTCCTGAAAACGATGGTGGAGCACCAGTGAAGAATTAC       c.86640
 S  A  V  L  S  W  D  V  P  E  N  D  G  G  A  P  V  K  N  Y         p.28880

          .         .         .         .         .         .       g.276371
 CACATAGAAAAACGTGAGGCCAGCAAGAAAGCATGGGTCTCTGTGACCAACAACTGTAAC       c.86700
 H  I  E  K  R  E  A  S  K  K  A  W  V  S  V  T  N  N  C  N         p.28900

          .         .         .         .         .         .       g.276431
 CGCCTCTCCTACAAAGTTACCAATTTACAAGAAGGAGCTATCTATTACTTCAGAGTCTCT       c.86760
 R  L  S  Y  K  V  T  N  L  Q  E  G  A  I  Y  Y  F  R  V  S         p.28920

          .         .         .         .         .         .       g.276491
 GGAGAAAATGAGTTTGGTGTTGGTATACCAGCTGAAACAAAGGAAGGAGTAAAAATAACA       c.86820
 G  E  N  E  F  G  V  G  I  P  A  E  T  K  E  G  V  K  I  T         p.28940

   | 328     .         .         .         .         .         .    g.277224
 G | AAAAACCAAGCCCACCTGAAAAACTTGGAGTAACAAGTATATCCAAAGACAGTGTTTCC    c.86880
 E |   K  P  S  P  P  E  K  L  G  V  T  S  I  S  K  D  S  V  S      p.28960

          .         .         .         .         .         .       g.277284
 CTGACCTGGCTGAAGCCTGAACATGATGGCGGAAGCAGAATTGTACACTATGTCGTTGAA       c.86940
 L  T  W  L  K  P  E  H  D  G  G  S  R  I  V  H  Y  V  V  E         p.28980

          .         .         .         .         .         .       g.277344
 GCACTAGAAAAAGGACAGAAAAACTGGGTTAAATGTGCAGTGGCAAAGTCAACCCATCAC       c.87000
 A  L  E  K  G  Q  K  N  W  V  K  C  A  V  A  K  S  T  H  H         p.29000

          .         .         .         .         .         .       g.277404
 GTTGTTTCCGGTCTGAGAGAGAATTCTGAATACTTTTTCCGAGTGTTTGCTGAAAATCAA       c.87060
 V  V  S  G  L  R  E  N  S  E  Y  F  F  R  V  F  A  E  N  Q         p.29020

          .         .         .         .         .         | 329    g.277569
 GCTGGCCTGAGTGACCCGAGAGAGCTTCTGCTTCCTGTTCTTATTAAGGAGCAACTAG | AA    c.87120
 A  G  L  S  D  P  R  E  L  L  L  P  V  L  I  K  E  Q  L  E |       p.29040

          .         .         .         .         .         .       g.277629
 CCACCTGAAATTGATATGAAGAATTTCCCAAGTCACACTGTATATGTTAGAGCTGGTTCA       c.87180
 P  P  E  I  D  M  K  N  F  P  S  H  T  V  Y  V  R  A  G  S         p.29060

          .         .         .         .         .         .       g.277689
 AACCTTAAAGTTGACATTCCAATCTCTGGAAAACCACTTCCCAAAGTGACCTTATCAAGA       c.87240
 N  L  K  V  D  I  P  I  S  G  K  P  L  P  K  V  T  L  S  R         p.29080

          .         .         .         .         .         .       g.277749
 GATGGTGTCCCCCTTAAGGCAACCATGAGATTTAATACCGAAATTACTGCTGAGAACCTG       c.87300
 D  G  V  P  L  K  A  T  M  R  F  N  T  E  I  T  A  E  N  L         p.29100

          .         .         .         .         .         .       g.277809
 ACCATCAATCTCAAAGAAAGTGTTACAGCTGACGCTGGGAGATATGAAATCACTGCTGCC       c.87360
 T  I  N  L  K  E  S  V  T  A  D  A  G  R  Y  E  I  T  A  A         p.29120

          .         .         .         .         .         .       g.277869
 AACTCCAGTGGTACAACCAAAGCTTTCATTAACATTGTTGTGCTAGACAGGCCTGGTCCT       c.87420
 N  S  S  G  T  T  K  A  F  I  N  I  V  V  L  D  R  P  G  P         p.29140

          .         .         .         .         .         .       g.277929
 CCAACTGGCCCTGTTGTTATTAGTGATATAACTGAAGAAAGTGTGACTCTCAAATGGGAG       c.87480
 P  T  G  P  V  V  I  S  D  I  T  E  E  S  V  T  L  K  W  E         p.29160

          .         .         .         .         .         .       g.277989
 CCACCTAAGTATGACGGTGGAAGTCAAGTTACCAACTACATTCTACTCAAAAGAGAAACA       c.87540
 P  P  K  Y  D  G  G  S  Q  V  T  N  Y  I  L  L  K  R  E  T         p.29180

          .         .         .         .         .         .       g.278049
 AGTACTGCAGTGTGGACTGAAGTGTCTGCAACAGTTGCAAGAACCATGATGAAAGTCATG       c.87600
 S  T  A  V  W  T  E  V  S  A  T  V  A  R  T  M  M  K  V  M         p.29200

          .         .         .         .         .         .       g.278109
 AAACTGACCACAGGAGAAGAATACCAATTCCGCATCAAGGCAGAAAACCGCTTTGGCATC       c.87660
 K  L  T  T  G  E  E  Y  Q  F  R  I  K  A  E  N  R  F  G  I         p.29220

          .         .         .         .       | 330.         .    g.278261
 AGTGATCATATAGATTCAGCTTGTGTGACTGTCAAACTACCATACA | CAACACCTGGACCA    c.87720
 S  D  H  I  D  S  A  C  V  T  V  K  L  P  Y  T |   T  P  G  P      p.29240

          .         .         .         .         .         .       g.278321
 CCATCTACACCATGGGTCACTAATGTTACTCGAGAAAGCATCACTGTGGGCTGGCATGAA       c.87780
 P  S  T  P  W  V  T  N  V  T  R  E  S  I  T  V  G  W  H  E         p.29260

          .         .         .         .         .         .       g.278381
 CCAGTGTCAAATGGAGGCAGTGCAGTCGTAGGCTATCACCTGGAAATGAAAGACAGAAAC       c.87840
 P  V  S  N  G  G  S  A  V  V  G  Y  H  L  E  M  K  D  R  N         p.29280

          .         .         .         .         .         .       g.278441
 AGTATTTTATGGCAAAAAGCCAACAAACTGGTCATCCGCACAACTCACTTCAAAGTCACA       c.87900
 S  I  L  W  Q  K  A  N  K  L  V  I  R  T  T  H  F  K  V  T         p.29300

          .         .         .         .         .         .       g.278501
 ACAATCAGTGCTGGACTTATTTATGAATTCAGGGTGTATGCAGAAAATGCTGCTGGAGTT       c.87960
 T  I  S  A  G  L  I  Y  E  F  R  V  Y  A  E  N  A  A  G  V         p.29320

          .         .         .         .          | 331       .    g.278669
 GGAAAACCTAGCCATCCTTCTGAACCAGTCTTGGCAATTGATGCTTGTG | AACCCCCAAGA    c.88020
 G  K  P  S  H  P  S  E  P  V  L  A  I  D  A  C  E |   P  P  R      p.29340

          .         .         .         .         .         .       g.278729
 AATGTTCGTATCACTGATATTTCAAAGAACTCTGTCAGCCTTTCATGGCAACAACCAGCT       c.88080
 N  V  R  I  T  D  I  S  K  N  S  V  S  L  S  W  Q  Q  P  A         p.29360

          .         .         .         .         .         .       g.278789
 TTCGATGGAGGTAGCAAGATTACAGGCTACATTGTTGAGAGACGTGACCTTCCAGATGGC       c.88140
 F  D  G  G  S  K  I  T  G  Y  I  V  E  R  R  D  L  P  D  G         p.29380

          .         .         .         .         .         .       g.278849
 AGATGGACCAAGGCCAGCTTCACCAATGTTACTGAAACTCAATTCATCATCTCTGGCTTG       c.88200
 R  W  T  K  A  S  F  T  N  V  T  E  T  Q  F  I  I  S  G  L         p.29400

          .         .         .         .         .         .       g.278909
 ACTCAGAATTCCCAGTATGAATTCCGTGTCTTTGCTAGGAATGCTGTTGGTTCCATTAGC       c.88260
 T  Q  N  S  Q  Y  E  F  R  V  F  A  R  N  A  V  G  S  I  S         p.29420

          .         .         .         .       | 332.         .    g.280664
 AATCCATCTGAGGTTGTAGGGCCCATTACTTGCATCGATTCTTATG | GTGGTCCTGTAATT    c.88320
 N  P  S  E  V  V  G  P  I  T  C  I  D  S  Y  G |   G  P  V  I      p.29440

          .         .         .         .         .         .       g.280724
 GATTTGCCTCTAGAATATACAGAAGTTGTCAAATACAGAGCAGGTACATCTGTGAAGCTC       c.88380
 D  L  P  L  E  Y  T  E  V  V  K  Y  R  A  G  T  S  V  K  L         p.29460

          .         .         .         .         .         .       g.280784
 AGAGCTGGCATTTCTGGCAAACCTGCGCCTACTATTGAGTGGTATAAAGATGATAAAGAA       c.88440
 R  A  G  I  S  G  K  P  A  P  T  I  E  W  Y  K  D  D  K  E         p.29480

          .         .         .         .         .         .       g.280844
 TTACAAACCAATGCACTGGTGTGTGTTGAAAATACCACGGACCTCGCATCTATACTCATC       c.88500
 L  Q  T  N  A  L  V  C  V  E  N  T  T  D  L  A  S  I  L  I         p.29500

          .         .         .         .         .         .       g.280904
 AAAGATGCCGATCGCCTTAATAGTGGATGCTATGAATTAAAACTAAGGAATGCCATGGGC       c.88560
 K  D  A  D  R  L  N  S  G  C  Y  E  L  K  L  R  N  A  M  G         p.29520

          .         .         .     | 333  .         .         .    g.281076
 TCAGCCTCAGCCACCATCAGAGTACAGATCCTTG | ACAAACCAGGCCCACCTGGTGGACCA    c.88620
 S  A  S  A  T  I  R  V  Q  I  L  D |   K  P  G  P  P  G  G  P      p.29540

          .         .         .         .         .         .       g.281136
 ATTGAATTTAAGACTGTAACTGCTGAGAAGATCACCCTTCTCTGGCGGCCTCCAGCTGAT       c.88680
 I  E  F  K  T  V  T  A  E  K  I  T  L  L  W  R  P  P  A  D         p.29560

          .         .         .         .         .         .       g.281196
 GATGGTGGTGCAAAAATCACTCACTACATTGTGGAAAAGCGTGAGACAAGCCGCGTTGTG       c.88740
 D  G  G  A  K  I  T  H  Y  I  V  E  K  R  E  T  S  R  V  V         p.29580

          .         .         .         .         .         .       g.281256
 TGGTCTATGGTGTCTGAACATTTGGAAGAGTGCATCATTACAACCACCAAAATTATCAAA       c.88800
 W  S  M  V  S  E  H  L  E  E  C  I  I  T  T  T  K  I  I  K         p.29600

          .         .         .         .         .         .       g.281316
 GGAAATGAATACATCTTCCGGGTCCGAGCCGTGAACAAATATGGAATTGGCGAGCCACTG       c.88860
 G  N  E  Y  I  F  R  V  R  A  V  N  K  Y  G  I  G  E  P  L         p.29620

          .         .         .     | 334  .         .         .    g.281612
 GAATCTGATTCCGTTGTAGCCAAGAACGCATTTG | TTACACCTGGGCCACCAGGCATACCA    c.88920
 E  S  D  S  V  V  A  K  N  A  F  V |   T  P  G  P  P  G  I  P      p.29640

          .         .         .         .         .         .       g.281672
 GAAGTGACAAAGATTACCAAGAATTCGATGACTGTTGTATGGAGCAGGCCAATTGCAGAT       c.88980
 E  V  T  K  I  T  K  N  S  M  T  V  V  W  S  R  P  I  A  D         p.29660

          .         .         .         .         .         .       g.281732
 GGCGGTAGTGATATAAGTGGCTATTTCCTTGAAAAACGAGACAAGAAGAGCCTAGGATGG       c.89040
 G  G  S  D  I  S  G  Y  F  L  E  K  R  D  K  K  S  L  G  W         p.29680

          .         .         .         .         .         .       g.281792
 TTTAAAGTACTAAAAGAGACTATCCGTGACACCAGACAAAAAGTAACAGGACTCACAGAA       c.89100
 F  K  V  L  K  E  T  I  R  D  T  R  Q  K  V  T  G  L  T  E         p.29700

          .         .         .         .         .         .       g.281852
 AACAGTGACTATCAATACAGAGTTTGTGCTGTAAACGCTGCTGGACAGGGTCCATTTTCT       c.89160
 N  S  D  Y  Q  Y  R  V  C  A  V  N  A  A  G  Q  G  P  F  S         p.29720

          .         .         .        | 335         .         .    g.282018
 GAACCATCTGAATTCTACAAAGCTGCTGATCCTATTG | ATCCTCCAGGTCCACCTGCTAAG    c.89220
 E  P  S  E  F  Y  K  A  A  D  P  I  D |   P  P  G  P  P  A  K      p.29740

          .         .         .         .         .         .       g.282078
 ATAAGAATCGCAGATTCAACCAAGTCATCCATCACCCTTGGCTGGAGTAAGCCTGTCTAT       c.89280
 I  R  I  A  D  S  T  K  S  S  I  T  L  G  W  S  K  P  V  Y         p.29760

          .         .         .         .         .         .       g.282138
 GATGGGGGCAGTGCTGTTACTGGGTATGTTGTCGAGATAAGACAAGGAGAGGAAGAGGAA       c.89340
 D  G  G  S  A  V  T  G  Y  V  V  E  I  R  Q  G  E  E  E  E         p.29780

          .         .         .         .         .         .       g.282198
 TGGACTACTGTCTCTACCAAAGGAGAGGTCAGAACTACAGAATATGTGGTATCCAACCTG       c.89400
 W  T  T  V  S  T  K  G  E  V  R  T  T  E  Y  V  V  S  N  L         p.29800

          .         .         .         .         .         .       g.282258
 AAACCTGGAGTCAATTACTACTTCCGGGTATCTGCTGTAAACTGTGCTGGACAAGGAGAA       c.89460
 K  P  G  V  N  Y  Y  F  R  V  S  A  V  N  C  A  G  Q  G  E         p.29820

          .         .         .         .    | 336   .         .    g.282423
 CCTATAGAAATGAATGAACCTGTACAAGCTAAAGATATACTTG | AGGCACCAGAGATTGAC    c.89520
 P  I  E  M  N  E  P  V  Q  A  K  D  I  L  E |   A  P  E  I  D      p.29840

          .         .         .         .         .         .       g.282483
 CTGGATGTGGCTCTCAGAACTTCTGTTATTGCCAAAGCTGGTGAAGATGTACAAGTGTTG       c.89580
 L  D  V  A  L  R  T  S  V  I  A  K  A  G  E  D  V  Q  V  L         p.29860

          .         .         .         .         .         .       g.282543
 ATTCCCTTTAAAGGCAGACCTCCACCTACTGTCACATGGAGAAAAGATGAGAAGAATCTT       c.89640
 I  P  F  K  G  R  P  P  P  T  V  T  W  R  K  D  E  K  N  L         p.29880

          .         .         .         .         .         .       g.282603
 GGCAGTGATGCCAGATACAGCATTGAAAACACTGATTCATCCTCATTACTCACCATTCCT       c.89700
 G  S  D  A  R  Y  S  I  E  N  T  D  S  S  S  L  L  T  I  P         p.29900

          .         .         .         .         .         .       g.282663
 CAAGTTACTCGCAATGATACAGGAAAATATATTCTCACAATAGAAAATGGAGTTGGTGAA       c.89760
 Q  V  T  R  N  D  T  G  K  Y  I  L  T  I  E  N  G  V  G  E         p.29920

          .         .         .         .         .         .       g.282723
 CCTAAGTCTTCAACTGTGAGTGTTAAAGTGCTTGACACACCAGCTGCCTGCCAGAAACTA       c.89820
 P  K  S  S  T  V  S  V  K  V  L  D  T  P  A  A  C  Q  K  L         p.29940

          .         .         .         .         .         .       g.282783
 CAGGTTAAACATGTTTCTCGAGGCACAGTCACTTTGCTCTGGGATCCTCCTCTCATTGAT       c.89880
 Q  V  K  H  V  S  R  G  T  V  T  L  L  W  D  P  P  L  I  D         p.29960

          .         .         .         .         .         .       g.282843
 GGAGGATCTCCAATAATTAATTATGTCATTGAAAAGAGAGATGCCACCAAGAGAACATGG       c.89940
 G  G  S  P  I  I  N  Y  V  I  E  K  R  D  A  T  K  R  T  W         p.29980

          .         .         .         .         .         .       g.282903
 TCTGTCGTGTCACACAAATGTTCTAGCACATCCTTCAAGCTAATAGATTTGTCGGAGAAG       c.90000
 S  V  V  S  H  K  C  S  S  T  S  F  K  L  I  D  L  S  E  K         p.30000

          .         .         .         .         .         .       g.282963
 ACTCCATTCTTCTTCAGAGTTCTTGCAGAAAATGAAATTGGAATTGGGGAACCCTGTGAA       c.90060
 T  P  F  F  F  R  V  L  A  E  N  E  I  G  I  G  E  P  C  E         p.30020

          .         .         .         .         .         .       g.283023
 ACTACAGAGCCAGTGAAGGCTGCTGAAGTACCAGCTCCTATACGTGATCTCTCAATGAAA       c.90120
 T  T  E  P  V  K  A  A  E  V  P  A  P  I  R  D  L  S  M  K         p.30040

          .         .         .         .         .         .       g.283083
 GACTCAACAAAGACATCTGTCATCCTCAGCTGGACCAAACCTGACTTTGATGGTGGTAGC       c.90180
 D  S  T  K  T  S  V  I  L  S  W  T  K  P  D  F  D  G  G  S         p.30060

          .         .         .         .         .         .       g.283143
 GTCATCACAGAATATGTTGTAGAAAGGAAAGGTAAAGGTGAACAGACGTGGTCCCACGCT       c.90240
 V  I  T  E  Y  V  V  E  R  K  G  K  G  E  Q  T  W  S  H  A         p.30080

          .         .         .         .         .         .       g.283203
 GGCATAAGTAAGACATGTGAAATTGAGGTTAGCCAACTTAAGGAGCAGTCAGTCCTGGAG       c.90300
 G  I  S  K  T  C  E  I  E  V  S  Q  L  K  E  Q  S  V  L  E         p.30100

          .         .         .         .         .         .       g.283263
 TTCAGAGTGTTTGCCAAAAATGAGAAAGGACTGAGTGATCCTGTCACTATTGGGCCAATT       c.90360
 F  R  V  F  A  K  N  E  K  G  L  S  D  P  V  T  I  G  P  I         p.30120

          .         .         .         .         .         .       g.283323
 ACAGTGAAAGAACTTATTATTACACCTGAAGTTGACCTGTCAGATATCCCTGGGGCACAA       c.90420
 T  V  K  E  L  I  I  T  P  E  V  D  L  S  D  I  P  G  A  Q         p.30140

          .         .         .         .         .         .       g.283383
 GTCACTGTGAGAATTGGGCACAATGTGCACCTTGAATTACCTTATAAGGGAAAACCCAAA       c.90480
 V  T  V  R  I  G  H  N  V  H  L  E  L  P  Y  K  G  K  P  K         p.30160

          .         .         .         .         .         .       g.283443
 CCATCCATCAGTTGGCTGAAAGATGGCTTGCCACTGAAAGAAAGTGAATTTGTTCGCTTC       c.90540
 P  S  I  S  W  L  K  D  G  L  P  L  K  E  S  E  F  V  R  F         p.30180

          .         .         .         .         .         .       g.283503
 AGTAAAACTGAAAACAAAATTACTTTGAGTATTAAGAATGCCAAGAAGGAGCATGGAGGA       c.90600
 S  K  T  E  N  K  I  T  L  S  I  K  N  A  K  K  E  H  G  G         p.30200

          .         .         .         .         .         .       g.283563
 AAATACACTGTTATTCTTGATAATGCAGTGTGTAGAATTGCAGTCCCCATTACAGTCATC       c.90660
 K  Y  T  V  I  L  D  N  A  V  C  R  I  A  V  P  I  T  V  I         p.30220

          .         .         .         .         .         .       g.283623
 ACCCTTGGCCCACCATCAAAGCCCAAAGGACCCATTCGATTTGATGAAATCAAGGCTGAT       c.90720
 T  L  G  P  P  S  K  P  K  G  P  I  R  F  D  E  I  K  A  D         p.30240

          .         .         .         .         .         .       g.283683
 AGTGTCATCCTGTCATGGGATGTACCTGAAGATAATGGAGGAGGAGAAATTACTTGTTAC       c.90780
 S  V  I  L  S  W  D  V  P  E  D  N  G  G  G  E  I  T  C  Y         p.30260

          .         .         .         .         .         .       g.283743
 AGCATCGAGAAGCGGGAAACTTCACAAACTAACTGGAAGATGGTGTGTTCAAGTGTTGCC       c.90840
 S  I  E  K  R  E  T  S  Q  T  N  W  K  M  V  C  S  S  V  A         p.30280

          .         .         .         .         .         .       g.283803
 AGAACGACTTTCAAAGTTCCTAATCTAGTCAAAGATGCTGAGTACCAGTTTAGAGTGAGA       c.90900
 R  T  T  F  K  V  P  N  L  V  K  D  A  E  Y  Q  F  R  V  R         p.30300

          .         .         .         .         .         .       g.283863
 GCAGAAAACAGATACGGAGTCAGCCAACCACTTGTCTCAAGCATTATTGTGGCAAAACAC       c.90960
 A  E  N  R  Y  G  V  S  Q  P  L  V  S  S  I  I  V  A  K  H         p.30320

          .         .         .         .         .         .       g.283923
 CAGTTCAGGATTCCTGGTCCCCCAGGAAAGCCAGTTATATACAATGTGACTTCTGATGGC       c.91020
 Q  F  R  I  P  G  P  P  G  K  P  V  I  Y  N  V  T  S  D  G         p.30340

          .         .         .         .         .         .       g.283983
 ATGTCACTAACTTGGGATGCTCCAGTTTATGATGGTGGTTCAGAAGTTACTGGATTCCAT       c.91080
 M  S  L  T  W  D  A  P  V  Y  D  G  G  S  E  V  T  G  F  H         p.30360

          .         .         .         .         .         .       g.284043
 GTTGAAAAGAAAGAAAGAAATAGCATCCTCTGGCAAAAAGTTAATACATCACCAATCTCT       c.91140
 V  E  K  K  E  R  N  S  I  L  W  Q  K  V  N  T  S  P  I  S         p.30380

          .         .         .         .         .         .       g.284103
 GGAAGAGAATATAGAGCCACTGGACTGGTAGAAGGTCTGGATTACCAATTCCGTGTATAT       c.91200
 G  R  E  Y  R  A  T  G  L  V  E  G  L  D  Y  Q  F  R  V  Y         p.30400

          .         .         .         .         .         .       g.284163
 GCTGAAAATTCTGCTGGCCTAAGCTCACCTAGTGACCCAAGCAAATTTACCTTAGCTGTT       c.91260
 A  E  N  S  A  G  L  S  S  P  S  D  P  S  K  F  T  L  A  V         p.30420

          . | 337      .         .         .         .         .    g.284592
 TCTCCAGTAG | ACCCACCTGGCACTCCTGACTACATTGATGTCACCCGGGAAACCATCACA    c.91320
 S  P  V  D |   P  P  G  T  P  D  Y  I  D  V  T  R  E  T  I  T      p.30440

          .         .         .         .         .         .       g.284652
 CTTAAATGGAACCCACCATTGCGTGATGGAGGCAGTAAGATTGTGGGCTATAGCATTGAG       c.91380
 L  K  W  N  P  P  L  R  D  G  G  S  K  I  V  G  Y  S  I  E         p.30460

          .         .         .         .         .         .       g.284712
 AAACGGCAAGGAAATGAACGCTGGGTGAGATGCAACTTTACTGACGTCAGTGAATGTCAG       c.91440
 K  R  Q  G  N  E  R  W  V  R  C  N  F  T  D  V  S  E  C  Q         p.30480

          .         .         .         .         .         .       g.284772
 TACACAGTTACAGGACTCAGTCCTGGGGATCGCTATGAGTTCAGAATAATTGCAAGAAAT       c.91500
 Y  T  V  T  G  L  S  P  G  D  R  Y  E  F  R  I  I  A  R  N         p.30500

          .         .         .         .         .         .       g.284832
 GCTGTTGGAACTATAAGCCCGCCCTCACAGTCTTCTGGCATTATTATGACAAGAGATGAA       c.91560
 A  V  G  T  I  S  P  P  S  Q  S  S  G  I  I  M  T  R  D  E         p.30520

      | 338  .         .         .         .         .         .    g.285585
 AATG | TTCCACCAATAGTAGAGTTTGGCCCTGAATACTTTGATGGTCTCATTATTAAGTCC    c.91620
 N  V |   P  P  I  V  E  F  G  P  E  Y  F  D  G  L  I  I  K  S      p.30540

          .         .         .         .         .         .       g.285645
 GGAGAGAGCCTTAGAATTAAAGCTTTGGTACAAGGAAGACCAGTGCCTCGAGTAACTTGG       c.91680
 G  E  S  L  R  I  K  A  L  V  Q  G  R  P  V  P  R  V  T  W         p.30560

          .         .         .         .         .         .       g.285705
 TTCAAAGATGGAGTGGAAATCGAAAAGAGGATGAATATGGAAATAACCGACGTACTTGGA       c.91740
 F  K  D  G  V  E  I  E  K  R  M  N  M  E  I  T  D  V  L  G         p.30580

          .         .         .         .         .         .       g.285765
 TCCACCAGCCTATTTGTTAGAGATGCTACTCGGGACCATCGTGGTGTATACACAGTGGAA       c.91800
 S  T  S  L  F  V  R  D  A  T  R  D  H  R  G  V  Y  T  V  E         p.30600

          .         .         .         .         .   | 339    .    g.285941
 GCCAAAAATGCATCTGGTTCTGCAAAAGCAGAAATTAAAGTGAAAGTACAAG | ATACACCA    c.91860
 A  K  N  A  S  G  S  A  K  A  E  I  K  V  K  V  Q  D |   T  P      p.30620

          .         .         .         .         .         .       g.286001
 GGAAAAGTAGTTGGGCCAATAAGATTCACCAATATTACTGGGGAGAAGATGACTCTGTGG       c.91920
 G  K  V  V  G  P  I  R  F  T  N  I  T  G  E  K  M  T  L  W         p.30640

          .         .         .         .         .         .       g.286061
 TGGGATGCCCCACTCAATGACGGTTGTGCTCCCATAACCCACTACATCATTGAAAAACGG       c.91980
 W  D  A  P  L  N  D  G  C  A  P  I  T  H  Y  I  I  E  K  R         p.30660

          .         .         .         .         .         .       g.286121
 GAAACCAGCAGACTTGCCTGGGCACTAATTGAGGATAAATGTGAAGCCCAAAGTTACACT       c.92040
 E  T  S  R  L  A  W  A  L  I  E  D  K  C  E  A  Q  S  Y  T         p.30680

          .         .         .         .         .         .       g.286181
 GCCATTAAACTAATAAACGGCAATGAATACCAATTCCGTGTTTCTGCAGTTAACAAGTTT       c.92100
 A  I  K  L  I  N  G  N  E  Y  Q  F  R  V  S  A  V  N  K  F         p.30700

          .         .         .         .         .   | 340    .    g.286337
 GGTGTTGGCAGGCCACTTGATTCTGATCCAGTGGTTGCTCAAATACAATATA | CTGTTCCT    c.92160
 G  V  G  R  P  L  D  S  D  P  V  V  A  Q  I  Q  Y  T |   V  P      p.30720

          .         .         .         .         .         .       g.286397
 GATGCCCCTGGCATTCCAGAACCTAGCAACATAACAGGCAACAGCATTACCCTGACATGG       c.92220
 D  A  P  G  I  P  E  P  S  N  I  T  G  N  S  I  T  L  T  W         p.30740

          .         .         .         .         .         .       g.286457
 GCAAGGCCAGAATCAGATGGTGGCAGTGAAATTCAACAGTATATCCTTGAAAGAAGAGAA       c.92280
 A  R  P  E  S  D  G  G  S  E  I  Q  Q  Y  I  L  E  R  R  E         p.30760

          .         .         .         .         .         .       g.286517
 AAGAAAAGCACAAGATGGGTAAAAGTGATCAGCAAACGACCAATCTCTGAAACAAGATTC       c.92340
 K  K  S  T  R  W  V  K  V  I  S  K  R  P  I  S  E  T  R  F         p.30780

          .         .         .         .         .         .       g.286577
 AAAGTCACTGGTCTGACAGAAGGCAATGAGTATGAATTCCATGTCATGGCTGAAAATGCT       c.92400
 K  V  T  G  L  T  E  G  N  E  Y  E  F  H  V  M  A  E  N  A         p.30800

          .         .         .         .         .         .       g.286637
 GCAGGAGTTGGACCTGCAAGTGGCATCTCAAGACTCATTAAATGTAGAGAGCCCGTCAAC       c.92460
 A  G  V  G  P  A  S  G  I  S  R  L  I  K  C  R  E  P  V  N         p.30820

          .         .         .         .         .         .       g.286697
 CCACCAGGTCCTCCCACAGTGGTCAAAGTAACAGACACATCAAAGACAACTGTGAGCTTA       c.92520
 P  P  G  P  P  T  V  V  K  V  T  D  T  S  K  T  T  V  S  L         p.30840

          .         .         .         .         .         .       g.286757
 GAATGGTCCAAACCAGTGTTTGATGGTGGCATGGAAATAATTGGGTATATTATTGAAATG       c.92580
 E  W  S  K  P  V  F  D  G  G  M  E  I  I  G  Y  I  I  E  M         p.30860

          .         .         .         .         .         .       g.286817
 TGTAAGGCCGACTTAGGAGACTGGCACAAGGTGAATGCAGAGGCATGTGTGAAAACAAGA       c.92640
 C  K  A  D  L  G  D  W  H  K  V  N  A  E  A  C  V  K  T  R         p.30880

          .         .         .         .         .         .       g.286877
 TATACAGTCACTGATCTACAAGCAGGTGAAGAATACAAATTCCGAGTTAGTGCTATCAAT       c.92700
 Y  T  V  T  D  L  Q  A  G  E  E  Y  K  F  R  V  S  A  I  N         p.30900

          .         .         .         .         .         .       g.286937
 GGTGCTGGAAAAGGCGACAGCTGTGAAGTGACTGGCACAATTAAAGCAGTTGACCGGTTA       c.92760
 G  A  G  K  G  D  S  C  E  V  T  G  T  I  K  A  V  D  R  L         p.30920

          .         .         .         .         .         .       g.286997
 ACAGCTCCTGAGTTAGACATAGATGCAAACTTCAAACAGACTCATGTTGTTAGAGCTGGG       c.92820
 T  A  P  E  L  D  I  D  A  N  F  K  Q  T  H  V  V  R  A  G         p.30940

          .         .         .         .         .         .       g.287057
 GCCAGTATTCGCCTCTTCATTGCCTACCAAGGTAGACCTACTCCTACAGCTGTGTGGAGC       c.92880
 A  S  I  R  L  F  I  A  Y  Q  G  R  P  T  P  T  A  V  W  S         p.30960

          .         .         .         .         .         .       g.287117
 AAACCAGACTCTAACCTTAGCCTTCGGGCTGATATCCATACAACAGATTCCTTCAGCACC       c.92940
 K  P  D  S  N  L  S  L  R  A  D  I  H  T  T  D  S  F  S  T         p.30980

          .         .         .         .         .         .       g.287177
 CTCACTGTGGAAAACTGCAACAGAAATGATGCAGGGAAATATACCCTTACTGTGGAAAAC       c.93000
 L  T  V  E  N  C  N  R  N  D  A  G  K  Y  T  L  T  V  E  N         p.31000

          .         .         .         .         .         .       g.287237
 AACAGTGGTAGTAAGTCAATCACATTCACCGTGAAAGTGCTAGACACTCCAGGCCCACCT       c.93060
 N  S  G  S  K  S  I  T  F  T  V  K  V  L  D  T  P  G  P  P         p.31020

          .         .         .         .         .         .       g.287297
 GGCCCAATTACCTTCAAAGATGTGACCCGGGGATCTGCTACATTGATGTGGGATGCCCCT       c.93120
 G  P  I  T  F  K  D  V  T  R  G  S  A  T  L  M  W  D  A  P         p.31040

          .         .         .         .         .         .       g.287357
 CTTCTTGACGGTGGTGCCCGAATCCATCATTATGTGGTAGAGAAACGAGAGGCAAGTCGC       c.93180
 L  L  D  G  G  A  R  I  H  H  Y  V  V  E  K  R  E  A  S  R         p.31060

          .         .         .         .         .         .       g.287417
 CGTAGTTGGCAGGTTATCAGTGAAAAATGCACTCGTCAGATCTTCAAGGTCAATGACCTG       c.93240
 R  S  W  Q  V  I  S  E  K  C  T  R  Q  I  F  K  V  N  D  L         p.31080

          .         .         .         .         .         .       g.287477
 GCCGAAGGTGTTCCGTACTATTTCCGTGTTTCTGCAGTAAATGAGTATGGTGTTGGTGAG       c.93300
 A  E  G  V  P  Y  Y  F  R  V  S  A  V  N  E  Y  G  V  G  E         p.31100

          .         .         .         .         .         .       g.287537
 CCCTATGAAATGCCAGAACCAATTGTAGCCACAGAACAGCCTGCTCCACCTAGGAGACTT       c.93360
 P  Y  E  M  P  E  P  I  V  A  T  E  Q  P  A  P  P  R  R  L         p.31120

          .         .         .         .         .         .       g.287597
 GATGTTGTTGATACTAGCAAATCCTCCGCAGTCTTAGCTTGGCTTAAACCTGACCACGAT       c.93420
 D  V  V  D  T  S  K  S  S  A  V  L  A  W  L  K  P  D  H  D         p.31140

          .         .         .         .         .         .       g.287657
 GGAGGCAGCCGGATCACTGGCTACCTGCTTGAAATGAGACAAAAGGGATCTGACTTCTGG       c.93480
 G  G  S  R  I  T  G  Y  L  L  E  M  R  Q  K  G  S  D  F  W         p.31160

          .         .         .         .         .         .       g.287717
 GTTGAAGCTGGTCACACCAAACAGCTAACTTTCACAGTAGAGCGTCTTGTTGAGAAAACT       c.93540
 V  E  A  G  H  T  K  Q  L  T  F  T  V  E  R  L  V  E  K  T         p.31180

          .         .         .         .         .         .       g.287777
 GAATATGAATTCCGTGTGAAGGCCAAGAATGATGCTGGCTATAGTGAACCCAGAGAAGCC       c.93600
 E  Y  E  F  R  V  K  A  K  N  D  A  G  Y  S  E  P  R  E  A         p.31200

          .         .         .         .         .         .       g.287837
 TTCTCTTCTGTCATCATTAAGGAGCCTCAAATCGAGCCCACTGCTGACCTCACTGGAATT       c.93660
 F  S  S  V  I  I  K  E  P  Q  I  E  P  T  A  D  L  T  G  I         p.31220

          .         .         .         .         .         .       g.287897
 ACCAATCAGCTTATAACTTGCAAAGCAGGAAGCCCATTTACCATTGACGTACCAATCAGT       c.93720
 T  N  Q  L  I  T  C  K  A  G  S  P  F  T  I  D  V  P  I  S         p.31240

          .         .         .         .         .         .       g.287957
 GGTCGTCCTGCCCCCAAAGTAACATGGAAACTGGAAGAAATGAGACTTAAAGAGACAGAT       c.93780
 G  R  P  A  P  K  V  T  W  K  L  E  E  M  R  L  K  E  T  D         p.31260

          .         .         .         .         .         .       g.288017
 CGAGTGAGCATTACAACAACAAAAGACAGAACCACACTGACTGTAAAGGACAGCATGAGA       c.93840
 R  V  S  I  T  T  T  K  D  R  T  T  L  T  V  K  D  S  M  R         p.31280

          .         .         .         .         .         .       g.288077
 GGTGACTCTGGAAGATACTTCTTGACCCTGGAAAATACAGCTGGTGTTAAAACATTTAGC       c.93900
 G  D  S  G  R  Y  F  L  T  L  E  N  T  A  G  V  K  T  F  S         p.31300

          .         .         .         .         .         .       g.288137
 GTCACAGTTGTGGTCATTGGAAGGCCAGGTCCAGTAACCGGCCCCATTGAGGTCTCATCT       c.93960
 V  T  V  V  V  I  G  R  P  G  P  V  T  G  P  I  E  V  S  S         p.31320

          .         .         .         .         .         .       g.288197
 GTCTCAGCTGAATCGTGTGTCCTGTCATGGGGAGAACCTAAAGATGGAGGAGGCACTGAA       c.94020
 V  S  A  E  S  C  V  L  S  W  G  E  P  K  D  G  G  G  T  E         p.31340

          .         .         .         .         .         .       g.288257
 ATTACTAATTACATAGTTGAAAAGCGTGAATCGGGTACAACAGCTTGGCAGCTTGTCAAT       c.94080
 I  T  N  Y  I  V  E  K  R  E  S  G  T  T  A  W  Q  L  V  N         p.31360

          .         .         .         .         .         .       g.288317
 TCCAGTGTCAAGCGCACTCAAATTAAAGTCACTCATCTCACAAAATACATGGAATATTCT       c.94140
 S  S  V  K  R  T  Q  I  K  V  T  H  L  T  K  Y  M  E  Y  S         p.31380

          .         .         .         .         .         .       g.288377
 TTCCGTGTCAGTTCAGAGAACAGATTTGGTGTCAGCAAACCTCTAGAATCAGCACCAATA       c.94200
 F  R  V  S  S  E  N  R  F  G  V  S  K  P  L  E  S  A  P  I         p.31400

          .          | 341       .         .         .         .    g.288538
 ATTGCTGAACATCCATTTG | TCCCACCAAGCGCTCCTACCAGACCTGAGGTCTACCATGTG    c.94260
 I  A  E  H  P  F  V |   P  P  S  A  P  T  R  P  E  V  Y  H  V      p.31420

          .         .         .         .         .         .       g.288598
 TCTGCCAATGCCATGTCTATTCGTTGGGAAGAACCCTACCACGATGGTGGCAGTAAAATC       c.94320
 S  A  N  A  M  S  I  R  W  E  E  P  Y  H  D  G  G  S  K  I         p.31440

          .         .         .         .         .         .       g.288658
 ATTGGCTACTGGGTTGAGAAGAAAGAACGTAATACAATTCTTTGGGTGAAAGAAAACAAA       c.94380
 I  G  Y  W  V  E  K  K  E  R  N  T  I  L  W  V  K  E  N  K         p.31460

          .         .         .         .         .         .       g.288718
 GTGCCATGCTTAGAGTGCAACTACAAAGTAACTGGTTTAGTAGAAGGACTGGAATATCAG       c.94440
 V  P  C  L  E  C  N  Y  K  V  T  G  L  V  E  G  L  E  Y  Q         p.31480

          .         .         .         .         .         .       g.288778
 TTCAGAACTTATGCACTCAATGCTGCAGGTGTTAGCAAGGCCAGCGAAGCTTCAAGACCT       c.94500
 F  R  T  Y  A  L  N  A  A  G  V  S  K  A  S  E  A  S  R  P         p.31500

          .         .   | 342    .         .         .         .    g.288935
 ATAATGGCTCAAAATCCAGTTG | ATGCACCAGGCAGACCAGAGGTGACAGATGTCACAAGA    c.94560
 I  M  A  Q  N  P  V  D |   A  P  G  R  P  E  V  T  D  V  T  R      p.31520

          .         .         .         .         .         .       g.288995
 TCAACAGTATCACTGATTTGGTCTGCCCCAGCGTATGATGGAGGCAGCAAGGTTGTGGGC       c.94620
 S  T  V  S  L  I  W  S  A  P  A  Y  D  G  G  S  K  V  V  G         p.31540

          .         .         .         .         .         .       g.289055
 TACATCATAGAGCGTAAGCCAGTCAGTGAGGTAGGAGATGGTCGCTGGCTGAAGTGCAAC       c.94680
 Y  I  I  E  R  K  P  V  S  E  V  G  D  G  R  W  L  K  C  N         p.31560

          .         .         .         .         .         .       g.289115
 TACACCATTGTATCTGACAATTTCTTCACCGTGACTGCTCTCAGTGAAGGAGACACTTAT       c.94740
 Y  T  I  V  S  D  N  F  F  T  V  T  A  L  S  E  G  D  T  Y         p.31580

          .         .         .         .         .         .       g.289175
 GAGTTCCGTGTGTTAGCCAAGAATGCAGCAGGCGTAATTAGCAAAGGGTCTGAATCTACA       c.94800
 E  F  R  V  L  A  K  N  A  A  G  V  I  S  K  G  S  E  S  T         p.31600

          .         .         | 343        .         .         .    g.289332
 GGCCCTGTCACTTGCCGAGATGAATACG | CTCCACCCAAAGCCGAACTGGATGCCCGATTA    c.94860
 G  P  V  T  C  R  D  E  Y  A |   P  P  K  A  E  L  D  A  R  L      p.31620

          .         .         .         .         .         .       g.289392
 CACGGTGATCTGGTTACCATCAGAGCAGGTTCTGATCTTGTTCTGGATGCTGCAGTTGGT       c.94920
 H  G  D  L  V  T  I  R  A  G  S  D  L  V  L  D  A  A  V  G         p.31640

          .         .         .         .         .         .       g.289452
 GGCAAACCTGAACCCAAAATTATCTGGACCAAAGGAGACAAGGAGCTAGATCTCTGTGAA       c.94980
 G  K  P  E  P  K  I  I  W  T  K  G  D  K  E  L  D  L  C  E         p.31660

          .         .         .         .         .         .       g.289512
 AAAGTCTCTTTGCAGTATACTGGCAAACGAGCAACTGCTGTGATCAAGTTCTGTGACAGA       c.95040
 K  V  S  L  Q  Y  T  G  K  R  A  T  A  V  I  K  F  C  D  R         p.31680

          .         .         .         .         .         .       g.289572
 AGTGACAGTGGAAAATACACTTTAACAGTGAAAAATGCCAGCGGGACCAAGGCCGTGTCT       c.95100
 S  D  S  G  K  Y  T  L  T  V  K  N  A  S  G  T  K  A  V  S         p.31700

          .          | 344       .         .         .         .    g.289727
 GTCATGGTCAAAGTGCTTG | ATTCCCCTGGCCCATGTGGAAAGCTCACCGTCAGCAGAGTA    c.95160
 V  M  V  K  V  L  D |   S  P  G  P  C  G  K  L  T  V  S  R  V      p.31720

          .         .         .         .         .         .       g.289787
 ACACAGGAGAAGTGCACTTTAGCCTGGAGCCTTCCGCAGGAAGACGGAGGAGCAGAAATC       c.95220
 T  Q  E  K  C  T  L  A  W  S  L  P  Q  E  D  G  G  A  E  I         p.31740

          .         .         .         .         .         .       g.289847
 ACTCACTACATCGTGGAAAGACGCGAGACTAGCAGGCTCAACTGGGTGATTGTTGAAGGC       c.95280
 T  H  Y  I  V  E  R  R  E  T  S  R  L  N  W  V  I  V  E  G         p.31760

          .         .         .         .         .         .       g.289907
 GAATGCCCAACCCTATCCTATGTCGTTACCAGGCTCATCAAGAACAATGAGTACATATTC       c.95340
 E  C  P  T  L  S  Y  V  V  T  R  L  I  K  N  N  E  Y  I  F         p.31780

          .         .         .         .         .         .       g.289967
 CGAGTGAGGGCAGTAAACAAATATGGCCCTGGTGTGCCTGTTGAATCAGAGCCAATTGTA       c.95400
 R  V  R  A  V  N  K  Y  G  P  G  V  P  V  E  S  E  P  I  V         p.31800

          .       | 345.         .         .         .         .    g.290153
 GCCAGAAACTCATTCA | CTATTCCATCACCACCCGGCATACCTGAAGAAGTTGGGACTGGC    c.95460
 A  R  N  S  F  T |   I  P  S  P  P  G  I  P  E  E  V  G  T  G      p.31820

          .         .         .         .         .         .       g.290213
 AAAGAGCATATCATCATTCAGTGGACAAAACCTGAATCTGATGGTGGCAATGAAATCAGC       c.95520
 K  E  H  I  I  I  Q  W  T  K  P  E  S  D  G  G  N  E  I  S         p.31840

          .         .         .         .         .         .       g.290273
 AACTACCTAGTAGACAAACGTGAGAAGAAGAGCCTGCGCTGGACACGTGTCAACAAAGAC       c.95580
 N  Y  L  V  D  K  R  E  K  K  S  L  R  W  T  R  V  N  K  D         p.31860

          .         .         .         .         .         .       g.290333
 TATGTGGTGTATGATACCAGGCTGAAGGTGACCAGCCTGATGGAGGGTTGTGATTACCAG       c.95640
 Y  V  V  Y  D  T  R  L  K  V  T  S  L  M  E  G  C  D  Y  Q         p.31880

          .         .         .         .         .         .       g.290393
 TTCCGGGTGACCGCAGTGAATGCAGCTGGTAACAGTGAGCCCAGCGAAGCTTCCAACTTC       c.95700
 F  R  V  T  A  V  N  A  A  G  N  S  E  P  S  E  A  S  N  F         p.31900

          .         .   | 346    .         .         .         .    g.291334
 ATCTCATGCAGAGAACCATCAT | ATACCCCTGGACCACCTTCTGCTCCAAGAGTTGTGGAT    c.95760
 I  S  C  R  E  P  S  Y |   T  P  G  P  P  S  A  P  R  V  V  D      p.31920

          .         .         .         .         .         .       g.291394
 ACCACCAAACACAGCATTAGTTTGGCATGGACCAAACCCATGTACGATGGTGGTACTGAC       c.95820
 T  T  K  H  S  I  S  L  A  W  T  K  P  M  Y  D  G  G  T  D         p.31940

          .         .         .         .         .         .       g.291454
 ATTGTAGGATATGTTCTGGAAATGCAAGAGAAGGACACTGATCAGTGGTACCGAGTGCAT       c.95880
 I  V  G  Y  V  L  E  M  Q  E  K  D  T  D  Q  W  Y  R  V  H         p.31960

          .         .         .         .         .         .       g.291514
 ACCAATGCCACAATAAGAAATACTGAATTCACTGTGCCAGACCTTAAAATGGGCCAGAAA       c.95940
 T  N  A  T  I  R  N  T  E  F  T  V  P  D  L  K  M  G  Q  K         p.31980

          .         .         .         .         .         .       g.291574
 TATTCCTTCAGAGTTGCTGCCGTGAACGTGAAGGGTATGAGCGAATACAGCGAATCAATT       c.96000
 Y  S  F  R  V  A  A  V  N  V  K  G  M  S  E  Y  S  E  S  I         p.32000

          .         .         | 347        .         .         .    g.291719
 GCTGAAATTGAGCCCGTGGAAAGAATAG | AAATACCAGATCTTGAGCTTGCAGATGATCTA    c.96060
 A  E  I  E  P  V  E  R  I  E |   I  P  D  L  E  L  A  D  D  L      p.32020

          .         .         .         .         .         .       g.291779
 AAGAAGACTGTGACCATCAGGGCTGGGGCCTCCTTGCGCTTGATGGTGTCTGTATCTGGA       c.96120
 K  K  T  V  T  I  R  A  G  A  S  L  R  L  M  V  S  V  S  G         p.32040

          .         .         .         .         .         .       g.291839
 AGACCACCTCCTGTCATAACGTGGAGCAAGCAGGGCATTGACCTTGCAAGCCGGGCAATT       c.96180
 R  P  P  P  V  I  T  W  S  K  Q  G  I  D  L  A  S  R  A  I         p.32060

          .         .         .         .         .         .       g.291899
 ATTGACACCACTGAGAGCTACTCATTGCTAATAGTGGACAAAGTTAATCGGTACGATGCT       c.96240
 I  D  T  T  E  S  Y  S  L  L  I  V  D  K  V  N  R  Y  D  A         p.32080

          .         .         .         .         .         .       g.291959
 GGAAAATACACAATTGAAGCTGAAAACCAATCTGGCAAGAAATCAGCAACAGTCCTTGTT       c.96300
 G  K  Y  T  I  E  A  E  N  Q  S  G  K  K  S  A  T  V  L  V         p.32100

          . | 348      .         .         .         .         .    g.292190
 AAAGTCTATG | ATACTCCTGGTCCCTGTCCTTCAGTGAAAGTTAAGGAAGTATCAAGAGAT    c.96360
 K  V  Y  D |   T  P  G  P  C  P  S  V  K  V  K  E  V  S  R  D      p.32120

          .         .         .         .         .         .       g.292250
 TCTGTGACTATAACTTGGGAAATTCCCACGATTGATGGTGGAGCTCCAGTCAACAATTAC       c.96420
 S  V  T  I  T  W  E  I  P  T  I  D  G  G  A  P  V  N  N  Y         p.32140

          .         .         .         .         .         .       g.292310
 ATCGTTGAGAAGCGTGAAGCTGCTATGAGAGCATTCAAAACAGTAACTACCAAATGCAGC       c.96480
 I  V  E  K  R  E  A  A  M  R  A  F  K  T  V  T  T  K  C  S         p.32160

          .         .         .         .         .         .       g.292370
 AAGACACTTTACAGAATTTCTGGACTTGTAGAAGGAACCATGTACTATTTCAGAGTGCTG       c.96540
 K  T  L  Y  R  I  S  G  L  V  E  G  T  M  Y  Y  F  R  V  L         p.32180

          .         .         .         .         .         .       g.292430
 CCAGAAAATATTTATGGCATTGGAGAACCTTGTGAAACATCTGATGCAGTACTGGTCTCA       c.96600
 P  E  N  I  Y  G  I  G  E  P  C  E  T  S  D  A  V  L  V  S         p.32200

          .         .         .         .         .         .       g.292490
 GAAGTGCCTTTGGTGCCTGCAAAGCTAGAAGTGGTCGATGTCACCAAATCCACTGTTACC       c.96660
 E  V  P  L  V  P  A  K  L  E  V  V  D  V  T  K  S  T  V  T         p.32220

          .         .         .         .         .         .       g.292550
 CTTGCCTGGGAAAAACCACTCTACGATGGTGGTAGCCGACTCACTGGATATGTTCTCGAG       c.96720
 L  A  W  E  K  P  L  Y  D  G  G  S  R  L  T  G  Y  V  L  E         p.32240

          .         .         .         .         .         .       g.292610
 GCCTGCAAAGCTGGCACAGAGAGATGGATGAAGGTTGTCACCTTAAAACCCACAGTCCTA       c.96780
 A  C  K  A  G  T  E  R  W  M  K  V  V  T  L  K  P  T  V  L         p.32260

          .         .         .         .         .         .       g.292670
 GAGCACACTGTTACTTCCTTAAATGAAGGTGAACAATACTTATTTAGAATAAGGGCACAA       c.96840
 E  H  T  V  T  S  L  N  E  G  E  Q  Y  L  F  R  I  R  A  Q         p.32280

          .         .         .         .         .         .       g.292730
 AATGAGAAAGGTGTGTCAGAACCAAGAGAGACTGTCACAGCCGTGACTGTACAAGACCTC       c.96900
 N  E  K  G  V  S  E  P  R  E  T  V  T  A  V  T  V  Q  D  L         p.32300

      | 349  .         .         .         .         .         .    g.292909
 AGAG | TGTTGCCAACAATCGATCTTTCTACAATGCCTCAGAAGACCATCCATGTCCCAGCT    c.96960
 R  V |   L  P  T  I  D  L  S  T  M  P  Q  K  T  I  H  V  P  A      p.32320

          .         .         .         .         .         .       g.292969
 GGCAGACCAGTAGAGCTGGTGATACCTATTGCTGGCCGTCCACCTCCTGCTGCTTCCTGG       c.97020
 G  R  P  V  E  L  V  I  P  I  A  G  R  P  P  P  A  A  S  W         p.32340

          .         .         .         .         .         .       g.293029
 TTCTTTGCTGGTTCTAAACTGAGAGAATCAGAGCGTGTCACAGTTGAAACTCACACTAAA       c.97080
 F  F  A  G  S  K  L  R  E  S  E  R  V  T  V  E  T  H  T  K         p.32360

          .         .         .         .         .         .       g.293089
 GTAGCTAAATTAACCATCCGTGAAACCACTATCAGAGATACTGGAGAATACACACTTGAA       c.97140
 V  A  K  L  T  I  R  E  T  T  I  R  D  T  G  E  Y  T  L  E         p.32380

          .         .         .         .         .   | 350    .    g.293247
 TTGAAGAATGTTACCGGAACTACTTCAGAAACCATTAAAGTTATCATTCTTG | ACAAGCCT    c.97200
 L  K  N  V  T  G  T  T  S  E  T  I  K  V  I  I  L  D |   K  P      p.32400

          .         .         .         .         .         .       g.293307
 GGTCCACCAACAGGACCTATTAAGATTGATGAAATTGATGCTACATCAATTACCATTTCC       c.97260
 G  P  P  T  G  P  I  K  I  D  E  I  D  A  T  S  I  T  I  S         p.32420

          .         .         .         .         .         .       g.293367
 TGGGAACCACCTGAATTGGACGGTGGTGCTCCACTGAGTGGTTATGTGGTAGAACAACGT       c.97320
 W  E  P  P  E  L  D  G  G  A  P  L  S  G  Y  V  V  E  Q  R         p.32440

          .         .         .         .         .         .       g.293427
 GACGCTCATCGTCCAGGATGGCTGCCCGTTTCTGAATCAGTGACTAGGTCCACGTTTAAG       c.97380
 D  A  H  R  P  G  W  L  P  V  S  E  S  V  T  R  S  T  F  K         p.32460

          .         .         .         .         .         .       g.293487
 TTTACCAGACTCACCGAAGGAAATGAGTATGTGTTCCGTGTGGCTGCAACAAACCGCTTC       c.97440
 F  T  R  L  T  E  G  N  E  Y  V  F  R  V  A  A  T  N  R  F         p.32480

          .         .         .         .         .   | 351    .    g.294226
 GGGATTGGCTCTTACTTGCAGTCTGAGGTCATAGAGTGTCGCAGCAGCATCC | GTATTCCT    c.97500
 G  I  G  S  Y  L  Q  S  E  V  I  E  C  R  S  S  I  R |   I  P      p.32500

          .         .         .         .         .         .       g.294286
 GGACCCCCAGAAACATTACAGATATTTGATGTTTCCCGTGATGGCATGACACTTACTTGG       c.97560
 G  P  P  E  T  L  Q  I  F  D  V  S  R  D  G  M  T  L  T  W         p.32520

          .         .         .         .         .         .       g.294346
 TACCCACCAGAGGATGACGGTGGCTCCCAAGTGACTGGATATATTGTGGAGCGCAAAGAA       c.97620
 Y  P  P  E  D  D  G  G  S  Q  V  T  G  Y  I  V  E  R  K  E         p.32540

          .         .         .         .         .         .       g.294406
 GTGAGAGCAGATCGATGGGTCCGTGTAAATAAAGTACCTGTGACAATGACACGGTACCGC       c.97680
 V  R  A  D  R  W  V  R  V  N  K  V  P  V  T  M  T  R  Y  R         p.32560

          .         .         .         .         .         .       g.294466
 TCCACTGGCCTTACTGAAGGCTTAGAATATGAACACCGTGTCACAGCCATTAATGCAAGA       c.97740
 S  T  G  L  T  E  G  L  E  Y  E  H  R  V  T  A  I  N  A  R         p.32580

          .         .         .         .         .      | 352 .    g.295437
 GGGTCTGGGAAACCAAGTCGTCCTTCCAAACCCATCGTTGCCATGGATCCAATTG | CTCCT    c.97800
 G  S  G  K  P  S  R  P  S  K  P  I  V  A  M  D  P  I  A |   P      p.32600

          .         .         .         .         .         .       g.295497
 CCAGGAAAGCCACAAAACCCAAGAGTTACTGATACAACAAGGACATCAGTCTCCCTGGCC       c.97860
 P  G  K  P  Q  N  P  R  V  T  D  T  T  R  T  S  V  S  L  A         p.32620

          .         .         .         .         .         .       g.295557
 TGGAGTGTTCCAGAAGATGAAGGAGGATCTAAAGTCACAGGCTACTTGATTGAAATGCAA       c.97920
 W  S  V  P  E  D  E  G  G  S  K  V  T  G  Y  L  I  E  M  Q         p.32640

          .         .         .         .         .         .       g.295617
 AAAGTAGATCAACATGAATGGACCAAGTGTAACACCACTCCAACCAAGATTCGAGAGTAT       c.97980
 K  V  D  Q  H  E  W  T  K  C  N  T  T  P  T  K  I  R  E  Y         p.32660

          .         .         .         .         .         .       g.295677
 ACTCTAACACACCTACCTCAGGGTGCAGAATACAGGTTCCGCGTCCTAGCTTGTAATGCT       c.98040
 T  L  T  H  L  P  Q  G  A  E  Y  R  F  R  V  L  A  C  N  A         p.32680

          .         .         .         .         .         | 353    g.295838
 GGTGGACCTGGTGAGCCTGCTGAGGTACCAGGAACAGTCAAAGTCACTGAAATGCTTG | AA    c.98100
 G  G  P  G  E  P  A  E  V  P  G  T  V  K  V  T  E  M  L  E |       p.32700

          .         .         .         .         .         .       g.295898
 TATCCTGATTATGAACTTGATGAAAGATACCAAGAAGGTATCTTTGTAAGGCAAGGTGGC       c.98160
 Y  P  D  Y  E  L  D  E  R  Y  Q  E  G  I  F  V  R  Q  G  G         p.32720

          .         .         .         .         .         .       g.295958
 GTCATCAGACTTACCATACCAATCAAAGGAAAACCATTCCCAATATGTAAATGGACCAAG       c.98220
 V  I  R  L  T  I  P  I  K  G  K  P  F  P  I  C  K  W  T  K         p.32740

          .         .         .         .         .         .       g.296018
 GAAGGCCAGGATATTAGTAAGCGTGCCATGATTGCAACATCTGAAACACACACTGAGCTT       c.98280
 E  G  Q  D  I  S  K  R  A  M  I  A  T  S  E  T  H  T  E  L         p.32760

          .         .         .         .         .         .       g.296078
 GTGATCAAAGAAGCAGACAGGGGTGATTCTGGCACTTATGACCTGGTTCTGGAAAATAAA       c.98340
 V  I  K  E  A  D  R  G  D  S  G  T  Y  D  L  V  L  E  N  K         p.32780

          .         .         .         .         .         .       g.296138
 TGTGGCAAGAAGGCTGTCTACATCAAGGTCAGGGTGATAGGAAGTCCCAACAGTCCAGAA       c.98400
 C  G  K  K  A  V  Y  I  K  V  R  V  I  G  S  P  N  S  P  E         p.32800

          .         .         .         .         .         .       g.296198
 GGGCCACTGGAATATGATGACATCCAAGTCCGCTCTGTGAGGGTCAGCTGGAGACCTCCT       c.98460
 G  P  L  E  Y  D  D  I  Q  V  R  S  V  R  V  S  W  R  P  P         p.32820

          .         .         .         .         .         .       g.296258
 GCTGATGATGGTGGTGCTGACATCTTAGGCTACATCCTCGAGAGACGAGAAGTGCCTAAA       c.98520
 A  D  D  G  G  A  D  I  L  G  Y  I  L  E  R  R  E  V  P  K         p.32840

          .         .         .         .         .         .       g.296318
 GCCGCCTGGTATACCATTGATTCCAGAGTCCGAGGTACATCTCTGGTGGTAAAAGGCCTC       c.98580
 A  A  W  Y  T  I  D  S  R  V  R  G  T  S  L  V  V  K  G  L         p.32860

          .         .         .         .         .         .       g.296378
 AAAGAGAATGTAGAATACCATTTCCGTGTTTCAGCAGAAAACCAGTTTGGCATAAGCAAA       c.98640
 K  E  N  V  E  Y  H  F  R  V  S  A  E  N  Q  F  G  I  S  K         p.32880

          .         .         .         .    | 354   .         .    g.296568
 CCCTTGAAATCTGAGGAACCAGTCACACCAAAAACACCATTGA | ATCCTCCAGAACCTCCA    c.98700
 P  L  K  S  E  E  P  V  T  P  K  T  P  L  N |   P  P  E  P  P      p.32900

          .         .         .         .         .         .       g.296628
 AGCAATCCTCCAGAAGTACTCGATGTAACCAAGAGTTCTGTTAGCTTGTCCTGGTCCCGG       c.98760
 S  N  P  P  E  V  L  D  V  T  K  S  S  V  S  L  S  W  S  R         p.32920

          .         .         .         .         .         .       g.296688
 CCCAAAGATGATGGTGGTTCTAGAGTCACAGGCTACTACATCGAACGCAAAGAGACATCC       c.98820
 P  K  D  D  G  G  S  R  V  T  G  Y  Y  I  E  R  K  E  T  S         p.32940

          .         .         .         .         .         .       g.296748
 ACTGACAAGTGGGTCAGACACAACAAGACTCAGATCACCACCACAATGTACACTGTCACA       c.98880
 T  D  K  W  V  R  H  N  K  T  Q  I  T  T  T  M  Y  T  V  T         p.32960

          .         .         .         .         .         .       g.296808
 GGGCTTGTTCCCGATGCTGAGTATCAGTTCCGCATCATCGCACAGAATGATGTTGGCCTG       c.98940
 G  L  V  P  D  A  E  Y  Q  F  R  I  I  A  Q  N  D  V  G  L         p.32980

          .         .         .         .          | 355       .    g.296974
 AGTGAGACCAGCCCTGCTTCTGAACCAGTTGTTTGCAAAGATCCATTTG | ATAAACCAAGC    c.99000
 S  E  T  S  P  A  S  E  P  V  V  C  K  D  P  F  D |   K  P  S      p.33000

          .         .         .         .         .         .       g.297034
 CAACCAGGAGAACTTGAGATTCTTTCAATATCCAAAGATAGTGTCACTCTACAGTGGGAG       c.99060
 Q  P  G  E  L  E  I  L  S  I  S  K  D  S  V  T  L  Q  W  E         p.33020

          .         .         .         .         .         .       g.297094
 AAACCTGAATGTGATGGTGGTAAAGAAATTCTTGGATACTGGGTTGAATATAGACAGTCT       c.99120
 K  P  E  C  D  G  G  K  E  I  L  G  Y  W  V  E  Y  R  Q  S         p.33040

          .         .         .         .         .         .       g.297154
 GGAGACAGTGCCTGGAAGAAGAGCAATAAGGAACGTATTAAGGACAAGCAATTCACAATA       c.99180
 G  D  S  A  W  K  K  S  N  K  E  R  I  K  D  K  Q  F  T  I         p.33060

          .         .         .         .         .         .       g.297214
 GGAGGTTTGCTGGAAGCTACTGAGTATGAATTCAGGGTTTTTGCTGAGAATGAGACTGGG       c.99240
 G  G  L  L  E  A  T  E  Y  E  F  R  V  F  A  E  N  E  T  G         p.33080

          .         .         .         .          | 356       .    g.297896
 CTGAGCAGACCTCGCAGAACTGCTATGTCTATAAAGACTAAACTCACAT | CTGGAGAGGCC    c.99300
 L  S  R  P  R  R  T  A  M  S  I  K  T  K  L  T  S |   G  E  A      p.33100

          .         .         .         .         .         .       g.297956
 CCAGGAATACGCAAAGAAATGAAGGATGTTACCACAAAATTGGGTGAAGCTGCTCAACTC       c.99360
 P  G  I  R  K  E  M  K  D  V  T  T  K  L  G  E  A  A  Q  L         p.33120

          .         .         .         .         .         .       g.298016
 TCATGCCAGATTGTTGGAAGGCCTCTTCCTGACATTAAATGGTACAGATTTGGTAAAGAG       c.99420
 S  C  Q  I  V  G  R  P  L  P  D  I  K  W  Y  R  F  G  K  E         p.33140

          .         .         .         .         .         .       g.298076
 CTCATACAAAGCCGGAAATACAAAATGTCTTCAGATGGACGCACACACACTCTTACAGTA       c.99480
 L  I  Q  S  R  K  Y  K  M  S  S  D  G  R  T  H  T  L  T  V         p.33160

          .         .         .         .         .         .       g.298136
 ATGACAGAGGAACAGGAAGATGAAGGTGTTTATACCTGCATAGCCACCAATGAGGTTGGA       c.99540
 M  T  E  E  Q  E  D  E  G  V  Y  T  C  I  A  T  N  E  V  G         p.33180

          .         .         .         .         .         .       g.298196
 GAAGTAGAAACCAGTAGTAAGCTTCTCCTGCAAGCAACACCGCAGTTCCATCCTGGTTAC       c.99600
 E  V  E  T  S  S  K  L  L  L  Q  A  T  P  Q  F  H  P  G  Y         p.33200

          .         .         .         .         .         .       g.298256
 CCACTGAAAGAGAAATATTATGGAGCTGTGGGTTCCACACTTCGGCTTCATGTTATGTAC       c.99660
 P  L  K  E  K  Y  Y  G  A  V  G  S  T  L  R  L  H  V  M  Y         p.33220

          .         .         .         .         .         .       g.298316
 ATTGGTCGTCCAGTACCTGCCATGACTTGGTTCCATGGTCAGAAACTTTTGCAAAACTCA       c.99720
 I  G  R  P  V  P  A  M  T  W  F  H  G  Q  K  L  L  Q  N  S         p.33240

          .         .         .         .         .         .       g.298376
 GAAAACATTACTATTGAAAACACTGAGCACTATACTCATCTTGTCATGAAGAATGTCCAA       c.99780
 E  N  I  T  I  E  N  T  E  H  Y  T  H  L  V  M  K  N  V  Q         p.33260

          .         .         .         .         .         .       g.298436
 CGTAAGACTCATGCTGGGAAATACAAAGTCCAGCTCAGCAATGTTTTTGGAACAGTTGAT       c.99840
 R  K  T  H  A  G  K  Y  K  V  Q  L  S  N  V  F  G  T  V  D         p.33280

          .         .      | 357 .         .         .         .    g.298594
 GCCATCCTTGATGTGGAAATACAAG | ATAAACCAGACAAACCTACAGGACCAATTGTGATC    c.99900
 A  I  L  D  V  E  I  Q  D |   K  P  D  K  P  T  G  P  I  V  I      p.33300

          .         .         .         .         .         .       g.298654
 GAAGCTCTATTGAAGAACTCCGCAGTGATCAGCTGGAAACCACCCGCAGATGACGGAGGC       c.99960
 E  A  L  L  K  N  S  A  V  I  S  W  K  P  P  A  D  D  G  G         p.33320

          .         .         .         .         .         .       g.298714
 TCCTGGATCACCAACTATGTGGTGGAAAAATGTGAGGCCAAGGAGGGGGCTGAATGGCAA       c.100020
 S  W  I  T  N  Y  V  V  E  K  C  E  A  K  E  G  A  E  W  Q         p.33340

          .         .         .         .         .         .       g.298774
 TTGGTGTCTTCAGCCATCTCAGTGACAACCTGTAGAATTGTGAACCTCACAGAAAATGCT       c.100080
 L  V  S  S  A  I  S  V  T  T  C  R  I  V  N  L  T  E  N  A         p.33360

          .         .         .         .         .         .       g.298834
 GGCTATTACTTCCGGGTTTCAGCTCAGAACACTTTCGGCATCAGTGACCCTCTAGAAGTG       c.100140
 G  Y  Y  F  R  V  S  A  Q  N  T  F  G  I  S  D  P  L  E  V         p.33380

          .         .         .  | 358     .         .         .    g.299256
 TCCTCAGTTGTGATCATTAAGAGTCCATTTG | AAAAGCCAGGTGCTCCTGGCAAACCAACT    c.100200
 S  S  V  V  I  I  K  S  P  F  E |   K  P  G  A  P  G  K  P  T      p.33400

          .         .         .         .         .         .       g.299316
 ATTACTGCTGTCACAAAAGATTCTTGTGTTGTGGCCTGGAAGCCACCTGCCAGTGATGGA       c.100260
 I  T  A  V  T  K  D  S  C  V  V  A  W  K  P  P  A  S  D  G         p.33420

          .         .         .         .         .         .       g.299376
 GGTGCAAAGATTAGAAATTACTACCTTGAGAAGCGTGAGAAGAAGCAGAATAAATGGATT       c.100320
 G  A  K  I  R  N  Y  Y  L  E  K  R  E  K  K  Q  N  K  W  I         p.33440

          .         .         .         .         .         .       g.299436
 TCTGTGACAACAGAAGAAATTCGAGAAACTGTCTTTTCAGTGAAAAACCTTATTGAAGGT       c.100380
 S  V  T  T  E  E  I  R  E  T  V  F  S  V  K  N  L  I  E  G         p.33460

          .         .         .         .         .         .       g.299496
 CTTGAATACGAGTTTCGTGTGAAATGTGAAAATCTAGGTGGGGAAAGTGAATGGAGTGAA       c.100440
 L  E  Y  E  F  R  V  K  C  E  N  L  G  G  E  S  E  W  S  E         p.33480

          .         .         .         .         .         .       g.299556
 ATATCAGAACCCATCACTCCCAAATCTGATGTCCCAATTCAGGCACCACACTTTAAAGAG       c.100500
 I  S  E  P  I  T  P  K  S  D  V  P  I  Q  A  P  H  F  K  E         p.33500

          .         .         .         .         .         .       g.299616
 GAACTGAGAAATCTAAATGTCAGATATCAGAGCAATGCTACCTTGGTCTGCAAAGTGACT       c.100560
 E  L  R  N  L  N  V  R  Y  Q  S  N  A  T  L  V  C  K  V  T         p.33520

          .         .         .         .         .         .       g.299676
 GGTCATCCAAAACCTATCGTCAAATGGTACAGACAAGGCAAAGAAATCATTGCAGATGGA       c.100620
 G  H  P  K  P  I  V  K  W  Y  R  Q  G  K  E  I  I  A  D  G         p.33540

          .         .         .         .         .         .       g.299736
 TTAAAATATAGGATTCAAGAATTTAAGGGTGGCTACCACCAGCTCATCATTGCAAGTGTC       c.100680
 L  K  Y  R  I  Q  E  F  K  G  G  Y  H  Q  L  I  I  A  S  V         p.33560

          .         .         .         .         .         .       g.299796
 ACAGATGATGATGCCACAGTTTACCAAGTCAGAGCTACCAACCAAGGGGGATCTGTGTCT       c.100740
 T  D  D  D  A  T  V  Y  Q  V  R  A  T  N  Q  G  G  S  V  S         p.33580

          .         .      | 359 .         .         .         .    g.299988
 GGCACTGCCTCCTTGGAAGTGGAAG | TTCCAGCTAAGATACACTTACCTAAAACTCTTGAA    c.100800
 G  T  A  S  L  E  V  E  V |   P  A  K  I  H  L  P  K  T  L  E      p.33600

          .         .         .         .         .         .       g.300048
 GGCATGGGAGCAGTTCATGCTCTCCGAGGTGAAGTGGTCAGCATCAAGATTCCTTTCAGT       c.100860
 G  M  G  A  V  H  A  L  R  G  E  V  V  S  I  K  I  P  F  S         p.33620

          .         .         .         .         .         .       g.300108
 GGCAAACCAGATCCTGTGATCACCTGGCAGAAAGGACAAGATCTCATTGACAATAATGGC       c.100920
 G  K  P  D  P  V  I  T  W  Q  K  G  Q  D  L  I  D  N  N  G         p.33640

          .         .         .         .         .         .       g.300168
 CACTACCAAGTTATTGTCACAAGATCCTTCACATCACTTGTTTTCCCCAATGGGGTAGAG       c.100980
 H  Y  Q  V  I  V  T  R  S  F  T  S  L  V  F  P  N  G  V  E         p.33660

          .         .         .         .         .         .       g.300228
 AGAAAAGATGCTGGTTTCTATGTGGTCTGTGCTAAAAACAGATTTGGAATTGATCAGAAG       c.101040
 R  K  D  A  G  F  Y  V  V  C  A  K  N  R  F  G  I  D  Q  K         p.33680

          .         .         .         .         .         .       g.300288
 ACAGTTGAACTGGATGTGGCTGATGTTCCTGACCCACCCAGAGGAGTCAAAGTTAGTGAT       c.101100
 T  V  E  L  D  V  A  D  V  P  D  P  P  R  G  V  K  V  S  D         p.33700

          .         .         .         .         .         .       g.300348
 GTCTCACGAGATTCTGTCAACTTAACATGGACTGAGCCAGCCTCTGATGGTGGCAGCAAA       c.101160
 V  S  R  D  S  V  N  L  T  W  T  E  P  A  S  D  G  G  S  K         p.33720

          .         .         .         .         .         .       g.300408
 ATCACCAACTACATTGTTGAAAAATGTGCAACTACTGCAGAAAGATGGCTCCGTGTAGGA       c.101220
 I  T  N  Y  I  V  E  K  C  A  T  T  A  E  R  W  L  R  V  G         p.33740

          .         .         .         .         .         .       g.300468
 CAGGCCCGAGAAACACGTTATACCGTGATCAACTTATTTGGAAAAACAAGTTACCAGTTC       c.101280
 Q  A  R  E  T  R  Y  T  V  I  N  L  F  G  K  T  S  Y  Q  F         p.33760

          .         .         .         .         .         .       g.300528
 CGGGTAATAGCTGAAAATAAATTTGGTCTGAGCAAGCCTTCAGAGCCTTCAGAACCAACC       c.101340
 R  V  I  A  E  N  K  F  G  L  S  K  P  S  E  P  S  E  P  T         p.33780

          .         .         .         .         .         .       g.300588
 ATAACCAAAGAAGATAAGACCAGAGCTATGAACTATGATGAAGAGGTAGATGAAACCAGG       c.101400
 I  T  K  E  D  K  T  R  A  M  N  Y  D  E  E  V  D  E  T  R         p.33800

          .         .         .         .         .         .       g.300648
 GAAGTCTCCATGACTAAAGCATCTCACTCTTCAACCAAGGAACTCTATGAGAAATATATG       c.101460
 E  V  S  M  T  K  A  S  H  S  S  T  K  E  L  Y  E  K  Y  M         p.33820

          .         .         .         .         .         .       g.300708
 ATTGCTGAAGATCTTGGGCGTGGTGAGTTTGGAATTGTCCATCGTTGTGTTGAAACATCC       c.101520
 I  A  E  D  L  G  R  G  E  F  G  I  V  H  R  C  V  E  T  S         p.33840

          .         .         .         .         .         .       g.300768
 TCAAAGAAGACATACATGGCCAAATTTGTTAAAGTCAAAGGGACTGATCAGGTTTTGGTA       c.101580
 S  K  K  T  Y  M  A  K  F  V  K  V  K  G  T  D  Q  V  L  V         p.33860

          .         .         .         .         .         .       g.300828
 AAGAAGGAAATTTCCATTCTGAATATTGCTAGGCATAGAAACATCTTACACCTCCATGAA       c.101640
 K  K  E  I  S  I  L  N  I  A  R  H  R  N  I  L  H  L  H  E         p.33880

          .         .         .         .         .         .       g.300888
 TCATTTGAAAGCATGGAAGAATTAGTTATGATCTTTGAGTTTATATCAGGACTTGACATA       c.101700
 S  F  E  S  M  E  E  L  V  M  I  F  E  F  I  S  G  L  D  I         p.33900

          .         .         .         .         .         .       g.300948
 TTTGAGCGCATTAACACAAGTGCTTTTGAACTTAATGAAAGAGAAATTGTAAGTTATGTT       c.101760
 F  E  R  I  N  T  S  A  F  E  L  N  E  R  E  I  V  S  Y  V         p.33920

          .         .         .         .         .         .       g.301008
 CACCAGGTCTGTGAAGCACTTCAGTTTTTACACAGTCATAATATTGGACACTTTGACATT       c.101820
 H  Q  V  C  E  A  L  Q  F  L  H  S  H  N  I  G  H  F  D  I         p.33940

          .         .         .         .         .         .       g.301068
 AGACCAGAAAATATCATTTACCAAACCAGAAGAAGCTCTACCATTAAAATCATAGAATTT       c.101880
 R  P  E  N  I  I  Y  Q  T  R  R  S  S  T  I  K  I  I  E  F         p.33960

          .         .         .         .         .         .       g.301128
 GGTCAAGCCCGTCAGCTGAAACCAGGGGACAACTTCAGGCTTCTATTCACTGCCCCAGAA       c.101940
 G  Q  A  R  Q  L  K  P  G  D  N  F  R  L  L  F  T  A  P  E         p.33980

          .         .         .         .         .         .       g.301188
 TACTATGCACCTGAAGTCCACCAGCATGATGTTGTCAGCACAGCCACAGACATGTGGTCA       c.102000
 Y  Y  A  P  E  V  H  Q  H  D  V  V  S  T  A  T  D  M  W  S         p.34000

          .         .         .         .         .         .       g.301248
 CTTGGAACACTGGTATATGTGCTATTGAGTGGTATCAACCCATTCCTGGCTGAAACTAAC       c.102060
 L  G  T  L  V  Y  V  L  L  S  G  I  N  P  F  L  A  E  T  N         p.34020

          .         .         .         .         .         .       g.301308
 CAACAGATCATTGAGAATATCATGAATGCTGAATATACTTTCGATGAGGAAGCATTCAAA       c.102120
 Q  Q  I  I  E  N  I  M  N  A  E  Y  T  F  D  E  E  A  F  K         p.34040

          .         .         .         .         .         .       g.301368
 GAGATTAGCATTGAAGCCATGGATTTTGTTGACCGGTTGTTAGTGAAAGAGAGGAAATCT       c.102180
 E  I  S  I  E  A  M  D  F  V  D  R  L  L  V  K  E  R  K  S         p.34060

          .         .         .         .         .         .       g.301428
 CGCATGACAGCATCGGAGGCTCTCCAGCACCCATGGTTGAAGCAGAAGATAGAAAGAGTC       c.102240
 R  M  T  A  S  E  A  L  Q  H  P  W  L  K  Q  K  I  E  R  V         p.34080

          .         .         .         .         .         .       g.301488
 AGTACTAAAGTTATCAGAACATTAAAACACCGGCGTTATTACCACACCCTGATCAAGAAA       c.102300
 S  T  K  V  I  R  T  L  K  H  R  R  Y  Y  H  T  L  I  K  K         p.34100

          .         .         .         .         .         .       g.301548
 GACCTCAACATGGTTGTGTCAGCAGCCCGGATCTCCTGTGGTGGTGCAATTCGATCTCAG       c.102360
 D  L  N  M  V  V  S  A  A  R  I  S  C  G  G  A  I  R  S  Q         p.34120

          .         .         .         .         .         .       g.301608
 AAGGGAGTGAGTGTTGCTAAAGTTAAAGTGGCATCCATTGAAATTGGCCCAGTTTCTGGG       c.102420
 K  G  V  S  V  A  K  V  K  V  A  S  I  E  I  G  P  V  S  G         p.34140

          .         .         .         .         .         .       g.301668
 CAGATAATGCATGCAGTTGGTGAAGAAGGAGGACATGTCAAATATGTATGCAAAATTGAA       c.102480
 Q  I  M  H  A  V  G  E  E  G  G  H  V  K  Y  V  C  K  I  E         p.34160

          .         .         .         .         .         .       g.301728
 AATTATGATCAGTCTACCCAAGTGACTTGGTACTTTGGCGTCCGACAGCTGGAGAACAGT       c.102540
 N  Y  D  Q  S  T  Q  V  T  W  Y  F  G  V  R  Q  L  E  N  S         p.34180

          .         .         .         .         .         .       g.301788
 GAGAAATACGAAATCACCTACGAAGATGGAGTGGCCATCCTCTATGTCAAAGACATTACC       c.102600
 E  K  Y  E  I  T  Y  E  D  G  V  A  I  L  Y  V  K  D  I  T         p.34200

          .         .         .         .         .         .       g.301848
 AAATTAGATGATGGTACCTACAGATGCAAAGTAGTCAATGACTATGGTGAAGACAGTTCT       c.102660
 K  L  D  D  G  T  Y  R  C  K  V  V  N  D  Y  G  E  D  S  S         p.34220

          .         .         .         .         .         .       g.301908
 TATGCAGAGCTATTTGTTAAAGGTGTGAGAGAAGTCTATGACTATTACTGCCGTAGAACC       c.102720
 Y  A  E  L  F  V  K  G  V  R  E  V  Y  D  Y  Y  C  R  R  T         p.34240

          .         .         .         .         .         .       g.301968
 ATGAAGAAAATTAAGCGCAGAACAGACACAATGAGACTCCTGGAAAGGCCACCAGAATTT       c.102780
 M  K  K  I  K  R  R  T  D  T  M  R  L  L  E  R  P  P  E  F         p.34260

          .         .         .         .         .         .       g.302028
 ACCCTGCCTCTCTATAATAAGACAGCTTATGTAGGTGAAAATGTCCGGTTTGGAGTAACT       c.102840
 T  L  P  L  Y  N  K  T  A  Y  V  G  E  N  V  R  F  G  V  T         p.34280

          .         .         .         .         .         .       g.302088
 ATAACTGTCCACCCAGAGCCTCATGTAACATGGTATAAATCAGGTCAGAAAATCAAACCA       c.102900
 I  T  V  H  P  E  P  H  V  T  W  Y  K  S  G  Q  K  I  K  P         p.34300

          .         .         .         .         .         .       g.302148
 GGTGACAATGACAAGAAGTACACATTTGAGTCAGACAAGGGTCTTTACCAATTAACAATC       c.102960
 G  D  N  D  K  K  Y  T  F  E  S  D  K  G  L  Y  Q  L  T  I         p.34320

          .         .         .         .         .         .       g.302208
 AACAGTGTCACTACAGATGATGACGCTGAATATACTGTTGTGGCAAGGAACAAATATGGT       c.103020
 N  S  V  T  T  D  D  D  A  E  Y  T  V  V  A  R  N  K  Y  G         p.34340

          .         .         .         .         .         .       g.302268
 GAAGACAGCTGTAAAGCAAAGCTGACAGTAACCCTACACCCACCTCCAACAGATAGTACC       c.103080
 E  D  S  C  K  A  K  L  T  V  T  L  H  P  P  P  T  D  S  T         p.34360

          .         .         .         .         .         .       g.302328
 TTAAGACCCATGTTCAAAAGGTTACTGGCAAATGCAGAATGCCAAGAAGGCCAAAGTGTC       c.103140
 L  R  P  M  F  K  R  L  L  A  N  A  E  C  Q  E  G  Q  S  V         p.34380

          .         .         .         .         .         .       g.302388
 TGCTTTGAGATCAGAGTGTCTGGCATCCCCCCACCAACATTAAAATGGGAGAAAGATGGT       c.103200
 C  F  E  I  R  V  S  G  I  P  P  P  T  L  K  W  E  K  D  G         p.34400

          .         .         .         .         .         .       g.302448
 CAGCCACTGTCCCTCGGGCCTAACATTGAAATTATCCATGAAGGCTTGGATTATTATGCT       c.103260
 Q  P  L  S  L  G  P  N  I  E  I  I  H  E  G  L  D  Y  Y  A         p.34420

          .         .         .         .         .         .       g.302508
 CTGCACATCAGGGACACTTTGCCTGAAGACACGGGTTATTATAGAGTCACAGCCACTAAC       c.103320
 L  H  I  R  D  T  L  P  E  D  T  G  Y  Y  R  V  T  A  T  N         p.34440

          .         .         .         .         .         .       g.302568
 ACAGCTGGGTCCACCAGCTGCCAGGCTCACCTACAAGTGGAACGCCTGAGGTACAAGAAA       c.103380
 T  A  G  S  T  S  C  Q  A  H  L  Q  V  E  R  L  R  Y  K  K         p.34460

          .         .         .         .         .         .       g.302628
 CAGGAATTCAAGAGTAAGGAGGAGCATGAGCGACACGTACAAAAACAAATTGACAAAACC       c.103440
 Q  E  F  K  S  K  E  E  H  E  R  H  V  Q  K  Q  I  D  K  T         p.34480

          .         .         .         .         .         .       g.302688
 CTCAGAATGGCTGAAATTCTTTCTGGAACTGAAAGTGTACCACTGACACAGGTAGCTAAA       c.103500
 L  R  M  A  E  I  L  S  G  T  E  S  V  P  L  T  Q  V  A  K         p.34500

          .         .         .         .         .         .       g.302748
 GAGGCTCTGAGAGAAGCTGCTGTCCTTTATAAACCGGCTGTAAGCACCAAGACTGTAAAA       c.103560
 E  A  L  R  E  A  A  V  L  Y  K  P  A  V  S  T  K  T  V  K         p.34520

          .         .         .         .         .         .       g.302808
 GGGGAATTCAGACTTGAGATAGAAGAAAAGAAGGAGGAGAGAAAACTCCGGATGCCTTAT       c.103620
 G  E  F  R  L  E  I  E  E  K  K  E  E  R  K  L  R  M  P  Y         p.34540

          .         .         .         .         .         .       g.302868
 GATGTACCAGAGCCACGCAAGTATAAGCAGACTACCATAGAAGAAGACCAACGCATCAAG       c.103680
 D  V  P  E  P  R  K  Y  K  Q  T  T  I  E  E  D  Q  R  I  K         p.34560

          .         .         .         .         .         .       g.302928
 CAGTTCGTGCCCATGTCTGACATGAAGTGGTATAAAAAGATACGTGATCAGTATGAAATG       c.103740
 Q  F  V  P  M  S  D  M  K  W  Y  K  K  I  R  D  Q  Y  E  M         p.34580

          .         .         .         .         .         .       g.302988
 CCTGGGAAACTTGACAGAGTTGTACAGAAACGACCCAAGCGCATCCGCCTTTCAAGATGG       c.103800
 P  G  K  L  D  R  V  V  Q  K  R  P  K  R  I  R  L  S  R  W         p.34600

          .         .         .         .         .         .       g.303048
 GAACAGTTCTATGTGATGCCTCTTCCACGCATTACAGATCAATACAGACCTAAATGGCGT       c.103860
 E  Q  F  Y  V  M  P  L  P  R  I  T  D  Q  Y  R  P  K  W  R         p.34620

          .         .         .         .         .         .       g.303108
 ATTCCTAAACTGTCCCAAGATGATCTTGAGATAGTGAGACCAGCCCGCCGGCGTACACCT       c.103920
 I  P  K  L  S  Q  D  D  L  E  I  V  R  P  A  R  R  R  T  P         p.34640

          .         .         .         .         .         .       g.303168
 TCTCCTGATTATGACTTTTACTACCGACCTAGAAGACGTTCTCTTGGGGACATCTCTGAT       c.103980
 S  P  D  Y  D  F  Y  Y  R  P  R  R  R  S  L  G  D  I  S  D         p.34660

          .         .         .         .         .         .       g.303228
 GAAGAATTACTCCTCCCCATTGATGACTACTTAGCAATGAAAAGAACAGAGGAAGAGAGG       c.104040
 E  E  L  L  L  P  I  D  D  Y  L  A  M  K  R  T  E  E  E  R         p.34680

          .         .         .         .         .         .       g.303288
 CTGCGTCTTGAAGAAGAGCTTGAGTTAGGTTTTTCAGCTTCACCCCCAAGTCGAAGCCCT       c.104100
 L  R  L  E  E  E  L  E  L  G  F  S  A  S  P  P  S  R  S  P         p.34700

          .         .         .         .         .         .       g.303348
 CCACACTTTGAGCTTTCTAGCCTACGTTACTCTTCACCACAAGCTCATGTCAAGGTGGAG       c.104160
 P  H  F  E  L  S  S  L  R  Y  S  S  P  Q  A  H  V  K  V  E         p.34720

          .         .         .         .         .         .       g.303408
 GAAACAAGAAAAGACTTCAGGTATTCAACCTATCACATCCCAACGAAGGCTGAAGCTAGT       c.104220
 E  T  R  K  D  F  R  Y  S  T  Y  H  I  P  T  K  A  E  A  S         p.34740

          .         .         .         .         .         .       g.303468
 ACAAGTTATGCAGAACTGAGGGAACGGCATGCCCAGGCTGCGTACAGACAGCCAAAGCAA       c.104280
 T  S  Y  A  E  L  R  E  R  H  A  Q  A  A  Y  R  Q  P  K  Q         p.34760

          .         .         .         .         .         .       g.303528
 CGGCAAAGAATCATGGCTGAGAGGGAGGATGAAGAGTTGCTTCGCCCAGTTACGACCACC       c.104340
 R  Q  R  I  M  A  E  R  E  D  E  E  L  L  R  P  V  T  T  T         p.34780

          .         .         .         .         .         .       g.303588
 CAGCATCTCTCAGAATACAAAAGCGAACTTGACTTCATGTCAAAGGAGGAAAAGTCTAGA       c.104400
 Q  H  L  S  E  Y  K  S  E  L  D  F  M  S  K  E  E  K  S  R         p.34800

          .         .         .         .         .         .       g.303648
 AAGAAATCAAGGCGACAAAGAGAAGTGACAGAAATAACAGAAATTGAGGAAGAATACGAA       c.104460
 K  K  S  R  R  Q  R  E  V  T  E  I  T  E  I  E  E  E  Y  E         p.34820

          .         .         .         .         .         .       g.303708
 ATCTCAAAACATGCTCAAAGAGAATCATCCTCATCTGCGTCTAGACTACTGAGACGACGG       c.104520
 I  S  K  H  A  Q  R  E  S  S  S  S  A  S  R  L  L  R  R  R         p.34840

          .         .         .         .         .         .       g.303768
 CGCTCCCTGTCTCCAACTTATATTGAGTTAATGAGGCCAGTGTCTGAGCTGATCCGGTCA       c.104580
 R  S  L  S  P  T  Y  I  E  L  M  R  P  V  S  E  L  I  R  S         p.34860

          .         .         .         .         .         .       g.303828
 CGTCCACAACCGGCTGAGGAATACGAAGATGACACAGAAAGAAGGTCACCTACTCCAGAG       c.104640
 R  P  Q  P  A  E  E  Y  E  D  D  T  E  R  R  S  P  T  P  E         p.34880

          .         .         .         .         .         .       g.303888
 AGAACTCGCCCACGATCCCCCAGCCCTGTGTCTAGTGAGAGATCACTCTCGAGATTTGAG       c.104700
 R  T  R  P  R  S  P  S  P  V  S  S  E  R  S  L  S  R  F  E         p.34900

          .         .         .         .         .         .       g.303948
 AGGTCTGCAAGATTTGATATCTTTTCCAGGTATGAGTCCATGAAAGCTGCTTTAAAAACT       c.104760
 R  S  A  R  F  D  I  F  S  R  Y  E  S  M  K  A  A  L  K  T         p.34920

          .         .         .         .         .         .       g.304008
 CAGAAGACATCAGAAAGGAAGTATGAAGTTTTGAGTCAGCAGCCTTTCACACTGGACCAT       c.104820
 Q  K  T  S  E  R  K  Y  E  V  L  S  Q  Q  P  F  T  L  D  H         p.34940

          .         .         .         .         .         .       g.304068
 GCCCCTCGAATCACACTGAGAATGCGCTCGCACAGGGTACCATGTGGCCAAAATACACGT       c.104880
 A  P  R  I  T  L  R  M  R  S  H  R  V  P  C  G  Q  N  T  R         p.34960

          .         .         .         .         .         .       g.304128
 TTTATTTTAAATGTTCAGTCTAAGCCAACTGCCGAGGTTAAATGGTACCACAATGGTGTG       c.104940
 F  I  L  N  V  Q  S  K  P  T  A  E  V  K  W  Y  H  N  G  V         p.34980

          .         .         .         .         .         .       g.304188
 GAACTCCAAGAAAGCAGTAAGATTCATTACACCAACACGAGTGGAGTCCTCACCCTGGAA       c.105000
 E  L  Q  E  S  S  K  I  H  Y  T  N  T  S  G  V  L  T  L  E         p.35000

          .         .         .         .         .         .       g.304248
 ATTCTGGACTGTCATACTGATGACAGTGGAACCTACCGTGCTGTGTGCACCAACTACAAG       c.105060
 I  L  D  C  H  T  D  D  S  G  T  Y  R  A  V  C  T  N  Y  K         p.35020

          .         .         .         .         .         .       g.304308
 GGCGAAGCTTCTGACTATGCAACGTTGGACGTGACAGGAGGGGATTATACCACCTATGCT       c.105120
 G  E  A  S  D  Y  A  T  L  D  V  T  G  G  D  Y  T  T  Y  A         p.35040

          .         .         .         .         .         .       g.304368
 TCCCAACGCAGAGATGAAGAGGTCCCCAGATCTGTTTTCCCTGAGCTGACAAGAACAGAG       c.105180
 S  Q  R  R  D  E  E  V  P  R  S  V  F  P  E  L  T  R  T  E         p.35060

          .         .         .         .         .         .       g.304428
 GCGTATGCTGTTTCATCATTTAAGAAAACATCTGAGATGGAAGCTTCGTCTTCTGTCAGG       c.105240
 A  Y  A  V  S  S  F  K  K  T  S  E  M  E  A  S  S  S  V  R         p.35080

          .         .         .         .         .         .       g.304488
 GAAGTGAAATCACAGATGACGGAGACAAGGGAAAGTCTCTCCTCATATGAACACTCTGCA       c.105300
 E  V  K  S  Q  M  T  E  T  R  E  S  L  S  S  Y  E  H  S  A         p.35100

          .         .         .         .         .         .       g.304548
 TCTGCAGAAATGAAAAGTGCTGCATTAGAAGAAAAGTCACTGGAAGAAAAATCCACAACC       c.105360
 S  A  E  M  K  S  A  A  L  E  E  K  S  L  E  E  K  S  T  T         p.35120

          .         .         .         .         .         .       g.304608
 AGAAAGATCAAGACGACTTTGGCAGCAAGAATTCTAACAAAGCCACGGTCCATGACCGTC       c.105420
 R  K  I  K  T  T  L  A  A  R  I  L  T  K  P  R  S  M  T  V         p.35140

          .         .         .         .         .         .       g.304668
 TACGAGGGCGAGTCTGCAAGGTTTTCTTGTGACACCGATGGTGAGCCGGTACCAACTGTG       c.105480
 Y  E  G  E  S  A  R  F  S  C  D  T  D  G  E  P  V  P  T  V         p.35160

          .         .         .         .         .         .       g.304728
 ACCTGGCTGCGTAAAGGACAAGTGCTAAGTACTTCTGCCCGCCACCAAGTGACCACCACA       c.105540
 T  W  L  R  K  G  Q  V  L  S  T  S  A  R  H  Q  V  T  T  T         p.35180

          .         .         .         .         .         .       g.304788
 AAGTACAAATCAACCTTTGAGATCTCTTCAGTCCAGGCTTCCGATGAGGGCAATTACAGC       c.105600
 K  Y  K  S  T  F  E  I  S  S  V  Q  A  S  D  E  G  N  Y  S         p.35200

          .         .         .         .         .         .       g.304848
 GTGGTGGTAGAAAACAGTGAAGGGAAACAAGAAGCAGAGTTCACTCTGACTATTCAAAAG       c.105660
 V  V  V  E  N  S  E  G  K  Q  E  A  E  F  T  L  T  I  Q  K         p.35220

          .         .         .         .         .         .       g.304908
 GCCAGGGTAACTGAAAAGGCTGTGACATCACCACCAAGAGTCAAATCCCCAGAGCCTCGG       c.105720
 A  R  V  T  E  K  A  V  T  S  P  P  R  V  K  S  P  E  P  R         p.35240

          .         .         .         .         .         .       g.304968
 GTGAAATCCCCAGAAGCAGTTAAGTCTCCAAAACGAGTGAAATCTCCAGAACCTTCTCAC       c.105780
 V  K  S  P  E  A  V  K  S  P  K  R  V  K  S  P  E  P  S  H         p.35260

          .         .         .         .         .         .       g.305028
 CCGAAAGCCGTATCACCCACAGAGACAAAACCAACACCAACAGAGAAAGTTCAGCACCTC       c.105840
 P  K  A  V  S  P  T  E  T  K  P  T  P  T  E  K  V  Q  H  L         p.35280

          .         .         .         .         .         .       g.305088
 CCAGTCTCTGCCCCACCAAAGATTACTCAGTTCCTGAAAGCAGAAGCTTCTAAAGAGATT       c.105900
 P  V  S  A  P  P  K  I  T  Q  F  L  K  A  E  A  S  K  E  I         p.35300

          .         .         .         .         .         .       g.305148
 GCAAAACTGACCTGTGTGGTTGAAAGCAGTGTATTAAGGGCAAAAGAGGTCACCTGGTAT       c.105960
 A  K  L  T  C  V  V  E  S  S  V  L  R  A  K  E  V  T  W  Y         p.35320

          .         .         .         .         .         .       g.305208
 AAAGATGGCAAGAAACTGAAGGAAAATGGGCATTTCCAGTTTCATTATTCAGCAGATGGT       c.106020
 K  D  G  K  K  L  K  E  N  G  H  F  Q  F  H  Y  S  A  D  G         p.35340

          .         .         .         .         .         .       g.305268
 ACCTATGAGCTCAAAATCAATAACCTCACTGAATCTGATCAAGGAGAATATGTTTGTGAG       c.106080
 T  Y  E  L  K  I  N  N  L  T  E  S  D  Q  G  E  Y  V  C  E         p.35360

          .         .         .         .         .         .       g.305328
 ATTTCTGGTGAAGGTGGAACGTCTAAAACCAACTTACAATTTATGGGGCAAGCCTTTAAG       c.106140
 I  S  G  E  G  G  T  S  K  T  N  L  Q  F  M  G  Q  A  F  K         p.35380

          .         .         .         .         .         .       g.305388
 AGTATCCATGAGAAGGTATCAAAAATATCAGAAACTAAGAAATCAGATCAGAAAACCACT       c.106200
 S  I  H  E  K  V  S  K  I  S  E  T  K  K  S  D  Q  K  T  T         p.35400

          .         .         .         .         .         .       g.305448
 GAGTCAACAGTAACCAGAAAAACTGAACCAAAAGCTCCTGAACCAATTTCCTCAAAACCA       c.106260
 E  S  T  V  T  R  K  T  E  P  K  A  P  E  P  I  S  S  K  P         p.35420

          .         .         .         .         .         .       g.305508
 GTAATTGTTACTGGGTTGCAGGATACAACTGTTTCTTCAGACAGTGTTGCTAAATTTGCA       c.106320
 V  I  V  T  G  L  Q  D  T  T  V  S  S  D  S  V  A  K  F  A         p.35440

          .         .         .         .         .     | 360  .    g.305692
 GTTAAGGCTACTGGAGAACCCCGGCCAACTGCCATCTGGACAAAAGATGGAAAG | GCCATT    c.106380
 V  K  A  T  G  E  P  R  P  T  A  I  W  T  K  D  G  K   | A  I      p.35460

          .         .         .         .         .         .       g.305752
 ACACAAGGAGGTAAATATAAACTCTCTGAAGACAAGGGAGGGTTCTTCTTAGAAATTCAT       c.106440
 T  Q  G  G  K  Y  K  L  S  E  D  K  G  G  F  F  L  E  I  H         p.35480

          .         .         .         .         .         .       g.305812
 AAGACTGATACTTCTGACAGTGGACTTTATACTTGTACAGTAAAAAATTCAGCTGGATCT       c.106500
 K  T  D  T  S  D  S  G  L  Y  T  C  T  V  K  N  S  A  G  S         p.35500

          .         .         .  | 361     .         .         .    g.306612
 GTGTCCTCTAGCTGCAAATTAACAATAAAAG | CTATAAAAGATACTGAGGCACAGAAAGTC    c.106560
 V  S  S  S  C  K  L  T  I  K  A |   I  K  D  T  E  A  Q  K  V      p.35520

          .         .         .         .         .         .       g.306672
 TCTACACAAAAGACTTCTGAAATTACACCTCAGAAGAAAGCTGTTGTCCAAGAGGAAATT       c.106620
 S  T  Q  K  T  S  E  I  T  P  Q  K  K  A  V  V  Q  E  E  I         p.35540

          .         .         .         .         .         .       g.306732
 TCCCAAAAAGCCCTAAGGTCTGAAGAAATTAAGATGTCAGAGGCAAAATCTCAAGAAAAG       c.106680
 S  Q  K  A  L  R  S  E  E  I  K  M  S  E  A  K  S  Q  E  K         p.35560

          .         .         .         .         .         .       g.306792
 TTAGCCCTCAAAGAGGAAGCTTCAAAGGTTCTGATTTCTGAAGAAGTCAAGAAATCAGCA       c.106740
 L  A  L  K  E  E  A  S  K  V  L  I  S  E  E  V  K  K  S  A         p.35580

          .         .         .         .         .         .       g.306852
 GCAACCTCCCTGGAAAAATCCATTGTCCATGAGGAAATCACTAAAACATCACAGGCATCA       c.106800
 A  T  S  L  E  K  S  I  V  H  E  E  I  T  K  T  S  Q  A  S         p.35600

          .         .         .         .         .         .       g.306912
 GAAGAAGTCAGAACTCATGCTGAGATTAAAGCATTTTCTACTCAGATGAGCATAAACGAA       c.106860
 E  E  V  R  T  H  A  E  I  K  A  F  S  T  Q  M  S  I  N  E         p.35620

          .         .         .         .         .         .       g.306972
 GGTCAAAGACTGGTTTTAAAAGCCAACATTGCTGGTGCCACTGATGTGAAATGGGTACTG       c.106920
 G  Q  R  L  V  L  K  A  N  I  A  G  A  T  D  V  K  W  V  L         p.35640

          .         .         .         .         .         .       g.307032
 AATGGCGTAGAGCTTACCAACTCTGAGGAGTACCGATATGGTGTCTCAGGCAGCGATCAG       c.106980
 N  G  V  E  L  T  N  S  E  E  Y  R  Y  G  V  S  G  S  D  Q         p.35660

          .         .         .         .         .         .       g.307092
 ACCCTAACCATCAAGCAAGCCAGTCACAGAGATGAAGGAATCCTCACCTGCATAAGCAAA       c.107040
 T  L  T  I  K  Q  A  S  H  R  D  E  G  I  L  T  C  I  S  K         p.35680

          .         .         .         .         .         .       g.307152
 ACCAAGGAAGGAATCGTCAAGTGTCAGTATGATTTGACACTGAGCAAAGAACTCTCAGAT       c.107100
 T  K  E  G  I  V  K  C  Q  Y  D  L  T  L  S  K  E  L  S  D         p.35700

          .         .         .         .         .         .       g.307212
 GCTCCAGCCTTCATCTCACAGCCTAGATCTCAAAATATTAATGAAGGACAAAATGTTCTC       c.107160
 A  P  A  F  I  S  Q  P  R  S  Q  N  I  N  E  G  Q  N  V  L         p.35720

          .         .         .         .         .         .       g.307272
 TTTACTTGTGAAATCAGTGGCGAGCCATCCCCTGAAATCGAATGGTTTAAAAACAACCTG       c.107220
 F  T  C  E  I  S  G  E  P  S  P  E  I  E  W  F  K  N  N  L         p.35740

     | 362   .         .         .         .         .         .    g.307432
 CCA | ATTTCTATTTCTTCAAATGTCAGCATAAGCCGCTCCAGAAATGTATACTCCCTTGAA    c.107280
 P   | I  S  I  S  S  N  V  S  I  S  R  S  R  N  V  Y  S  L  E      p.35760

          .         .         .         .         .         .       g.307492
 ATCCGAAATGCATCAGTCAGCGACAGTGGAAAGTACACAATTAAGGCCAAAAATTTCCGT       c.107340
 I  R  N  A  S  V  S  D  S  G  K  Y  T  I  K  A  K  N  F  R         p.35780

          .         .         .        | 363         .         .    g.308077
 GGCCAGTGTTCAGCTACAGCTTCCTTAATGGTCCTTC | CTCTAGTTGAAGAACCTTCCAGA    c.107400
 G  Q  C  S  A  T  A  S  L  M  V  L  P |   L  V  E  E  P  S  R      p.35800

          .         .         .         .         .         .       g.308137
 GAGGTAGTATTGAGAACAAGTGGTGACACAAGCTTGCAAGGAAGCTTCTCGTCTCAGTCA       c.107460
 E  V  V  L  R  T  S  G  D  T  S  L  Q  G  S  F  S  S  Q  S         p.35820

          .         .         .         .         .         .       g.308197
 GTCCAAATGTCTGCCTCCAAGCAGGAGGCCTCCTTCAGCAGTTTCAGCAGCAGCAGTGCT       c.107520
 V  Q  M  S  A  S  K  Q  E  A  S  F  S  S  F  S  S  S  S  A         p.35840

          .         .         .         .         .         .       g.308257
 AGCAGCATGACTGAGATGAAATTTGCAAGCATGTCTGCCCAAAGCATGTCCTCCATGCAA       c.107580
 S  S  M  T  E  M  K  F  A  S  M  S  A  Q  S  M  S  S  M  Q         p.35860

          .         .         .         .         .         .       g.308317
 GAGTCCTTTGTAGAAATGAGTTCCAGCAGCTTTATGGGAATATCTAATATGACACAACTG       c.107640
 E  S  F  V  E  M  S  S  S  S  F  M  G  I  S  N  M  T  Q  L         p.35880

          .         .         .         . | 364      .         .    g.308515
 GAAAGCTCAACTAGTAAAATGCTTAAAGCAGGCATAAGAG | GAATTCCGCCTAAAATTGAA    c.107700
 E  S  S  T  S  K  M  L  K  A  G  I  R  G |   I  P  P  K  I  E      p.35900

          .         .         .         .         .         .       g.308575
 GCTCTTCCATCTGATATCAGCATTGATGAAGGCAAAGTTCTAACAGTAGCCTGTGCTTTC       c.107760
 A  L  P  S  D  I  S  I  D  E  G  K  V  L  T  V  A  C  A  F         p.35920

          .         .         .         .         .         .       g.308635
 ACGGGTGAGCCTACCCCAGAAGTAACATGGTCCTGTGGTGGAAGAAAAATCCACAGTCAA       c.107820
 T  G  E  P  T  P  E  V  T  W  S  C  G  G  R  K  I  H  S  Q         p.35940

          .         .         .         .         .         .       g.308695
 GAACAGGGGAGGTTCCACATTGAAAACACAGATGACCTGACAACCCTGATCATCATGGAC       c.107880
 E  Q  G  R  F  H  I  E  N  T  D  D  L  T  T  L  I  I  M  D         p.35960

          .         .         .         .         .         .       g.308755
 GTACAGAAACAAGATGGTGGACTTTATACCCTGAGTTTAGGGAATGAATTTGGATCTGAC       c.107940
 V  Q  K  Q  D  G  G  L  Y  T  L  S  L  G  N  E  F  G  S  D         p.35980

          .         .         .                                     g.308791
 TCTGCCACTGTGAATATACATATTCGATCCATTTAA                               c.107976
 S  A  T  V  N  I  H  I  R  S  I  X                                 p.35991

          .         .         .         .         .         .       g.308851
 gagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacgg       c.*60

          .         .         .         .         .         .       g.308911
 actaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaa       c.*120

          .         .         .         .         .         .       g.308971
 tgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatata       c.*180

          .         .         .         .         .         .       g.309031
 atacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagtttt       c.*240

          .         .         .         .         .         .       g.309091
 gtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggaga       c.*300

          .         .         .         .         .         .       g.309151
 aagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacata       c.*360

          .         .         .         .         .         .       g.309211
 ctgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtc       c.*420

          .         .         .         .         .         .       g.309271
 cacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaat       c.*480

          .         .         .         .         .         .       g.309331
 cagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgt       c.*540

          .         .         .         .         .         .       g.309391
 cttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaag       c.*600

          .         .         .         .         .         .       g.309451
 tgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctga       c.*660

          .         .         .         .         .         .       g.309511
 atagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtat       c.*720

          .         .         .         .         .         .       g.309571
 tcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgt       c.*780

          .         .         .         .         .         .       g.309631
 ggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagc       c.*840

          .         .         .         .         .         .       g.309691
 aaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaat       c.*900

          .         .         .         .         .         .       g.309751
 tgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagtt       c.*960

          .         .         .         .         .         .       g.309811
 ataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctca       c.*1020

                                                                    g.309814
 aaa                                                                c.*1023

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Titin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 35
2004-2013 Leiden University Medical Center