(last modified on November 21, 2003)
(full address: Donald R. Love, Molecular Genetics, School of Biological Sciences, University of Auckland, Private Bag 92019, AUCKLAND, New Zealand)
Extraction of genomic DNA from muscle tissue was carried out using Puregene DNA isolation kit (Gentra, USA) according to the manufacturer's protocol.
Each DNA sample was amplified using 32 pairs of primers, which are shown in the accompanying Figure and Table. All primers were checked against the
NCBI SNP database and the HGVbase to avoid overlapping with
SNPs.
All PCR volumes were 50 ul (except amplification of sarcoglycan beta exon 1) and contained
0.025 units/ul AmpliTaq Gold (Applied Biosystems), 0.2 mM of each dNTP, 5 ul 10xPCR buffer
(Applied Biosystems), 1 ng/ul DNA and 0.2 uM of each forward and reverse primer. For the amplification of exon 1 of beta
sarcoglycan, the GC-rich PCR kit (Invitrogen) was used according to the manufacturer's instructions. In brief, reaction volumes were
50 ul and contained 1 ng/ul DNA, 0.2 mM of each dNTP, 0.4 mM of each forward and reverse primer, GC-rich resolution buffer
(15 ml in 35 ml of mix 1) and 1x GC-rich PCR buffer containing DMSO.
The amplification conditions involved an initial 10 min at 95oC followed by 35 cycles of denaturation at
95oC for 30 sec, annealing at 60oC for 30 sec, and extension at
72oC for 30 sec. The final extension at 72oC was prolonged to 10
min.
A mixture of 15ul of each amplicon from patient DNA and from a normal individual was heated for 5
min at 95oC, and then cooled to room temperature. A Transgenomic WAVE DNA Fragment Analysis System
(Transgenomic, Inc.) and associated WAVEMAKER software were used. An aliquot (5
ul) of the DNA mixtures were directly injected into a DNASep column. Each fragment was analyzed using three partially denaturing temperatures
(see PCR primers and DHPLC conditions and the sarcoglycan
exon sequences [SGCA, SGCB,
SGCG, SGCD]), which were determined empirically based on fragment melting profiles.
The column mobile phase for sample elution consisted of a mixture of the following: Buffer A, 0.1 M TEAA
(triethylammonium acetate), and Buffer B, 0.1 M TEAA with 25% acetonitrile. Samples were eluted at a linear gradient of Buffer B over a 4.5-minute period at a constant flow rate of 0.9 ml/min.
The starting gradient varied among fragments, depending upon the DNA sequence and fragment size, and was determined by the WAVEMaker software. The chromatograms of each fragment were compared to those obtained from normal DNA
alone. Fragments containing heteroduplexes with a shorter retention time compared to normal controls were sequenced to confirm putative sequence variations.
PCR products were purified using Concert Rapid PCR Purification System (Invitrogen). Sequencing was performed by using a model 3100 Automated Sequencer Genetic Analyser ( Applied Biosystems), and dye terminator chemistry. Sequence alignments and analysis were performed using the Autoassembler computer program ( Applied Biosystems).
NOTE: optimum temperatures for DHPLC analysis were empirically determined using the predicted fragment melting profile generated by the WaveMaker software.
SGCA exon sequences with DHPLC-primers
| Exon | Length (in bp) | Tm (in oC) | DHPLC gradient | DHPLC
temperatures (in oC) | Forward primer / reverse primer |
|---|---|---|---|---|---|
| 1 | 160 | 66 | 48-57 | 64, 65, 66 | cttccctcctctcctccctg* / cacccctaaatcctgcccc |
| 2 | 240 | 65 | 52-61 | 64, 65, 66 | agcttatcccctgcccagg / ggagccctgcggggtacac |
| 3 | 270 | 64 | 53-62 | 65, 66, 67 | gcagggctcctgctgtgact / tcatagggctgctcctaggagg |
| 4 | 180 | 63 | 49-58 | 63, 64, 65 | gtgccacgtttctcccctaac / gagattccccaagactggcat |
| 5 | 329 | 63 | 55-64 | 64, 65, 66 | cttcaaggaggctttgcgg / tctatgcccgccacaagctg |
| 6 | 311 | 63 | 55-64 | 63, 64, 65 | ttcaacaacccctggcagagt / atgggagggaagggggact |
| 7 | 320 | 65 | 55-64 | 64, 65, 66 | tgtgtccagccagccactt / actgtgagtcccatgggtgtg |
| 8 | 122 | 63 | 40-49 | 63, 64, 65 | gaaacccagagctgggctaa / caacaactgtctaggtgggctc |
| 9 | 320 | 63 | 55-64 | 64, 65, 66 | tccaggctgtactccagggc / cccagccttgtgataaaggc |
| 10 | 340 | 63 | 55-64 | 62, 63, 64 | ggaagtcaggagaaccagcatct / aggcactggctgcctatgg |
NOTE: *primer has several annealing sites in the human genome !!
| Exon | Length (in bp) | Tm (in oC) | DHPLC gradient | DHPLC
temperatures (in oC) | Forward primer / reverse primer |
|---|---|---|---|---|---|
| 1 | 206 | 71 | 50-59 | 69, 70, 71 | agcagcgggtgcccccagtc / agccggcaggacgcggcct |
| 2 | 310 | 56 | 55-64 | 56, 57, 58 | caccaaaacgagagggtatagctg / taaaaaattccccatggcaatta |
| 3 | 300 | 59 | 54-63 | 57, 58, 59 | ttccaattacattaaatgtatgcgg / tttttctctaatgcccctctcct |
| 4 | 303 | 54 | 54-63 | 55, 56, 57 | ttgcagtcttctttgaaaatatattcac / ccactttataactctagagaataattctctccc |
| 5 | 245 | 54 | 52-61 | 54, 55, 57 | caattctcacattaatttagaaactctttttagta / atggatttatgtacccaagaacctaataat |
| 6 | 312 | 55 | 55-64 | 55, 58, 62 | ttctgtaccccctcatggagg / CATGCATAAAAAAGTCAAGTCAAGATATAAAC |
| Exon | Length (in bp) | Tm (in oC) | DHPLC gradient | DHPLC
temperatures (in oC) | Forward primer / reverse primer |
|---|---|---|---|---|---|
| 1 | 236 | 55 | 52-61 | 55, 57, 59 | ggatgaaacatgagacagggc / tttggtttttaggtagtactttgtactgatataa |
| 2 | 300 | 56 | 54-63 | 55, 56, 57 | cctcattccctctctgtctctttc / atacagtgaacaaaacaagaacatgct |
| 3 | 210 | 54 | 51-60 | 54, 55, 56 | gaaaaagcaagcaataaaaatatacgc / ttaaacatgatttatttttcataaagcaca |
| 4 | 210 | 55 | 51-60 | 55, 57, 59 | tataaagatataatcattttaaacagcacctattt / ttcatttagcactattcatggacaaca |
| 5 | 225 | 57 | 51-60 | 56, 57, 58 | tggacactgcttgtagtgaacagtt / ttttgcagatgtgtactccatgg |
| 6 | 175 | 56 | 49-58 | 56, 57, 59 | ggtgtcacttattttacttctgctcct / cctcttgtcttctacaggagaggttg |
| 7 | 240 | 57 | 52-61 | 55, 57, 58 | agtggctatttttaatacttttttttttttttt / tactcaggaatatcatcaggacatacagta |
| 8 | 250 | 63 | 53-62 | 61, 62, 63 | agggtggcccttccttaactc / GCACAGCTCACCGAGAGGAC |
| Exon | Length (in bp) | Tm (in oC) | DHPLC gradient | DHPLC
temperatures (in oC) | Forward primer / reverse primer |
|---|---|---|---|---|---|
| 1 | 173 | 60 |
49-58 | 59, 60, 62 | atttcctaggcaaggaggggg / ttaataataaaatgaccatgagcaggg |
| 2 | 342 | 58 | 55-64 | 57, 58, 59 | ctcttctctcagcggtttaatgtgagt* / taataatatcacttttccacattccttcat |
| 3 | 282 | 56 | 54-63 | 56, 57, 58 | aaaaaaaaggctataactacgttttttacag / ctgtactcagctgatagcaagatcaat |
| 4 | 250 | 55 | 53-62 | 56, 57, 58 | atgacagttctttttgtttagaaatctatcat / ggctataactacgttttttacag |
| 5 | 283 | 57 | 54-63 | 55, 56, 57 | taatggtgttttctctctctctctctcc / tttgggaggacatatcctgttca |
| 6 | 280 | 58 | 49-58 | 57, 58, 59 | gtgcctacaggtgactccagtatct / agcaaggcaatagccattaatca |
| 7 | 340 | 58 | 55-64 | 58, 59, 60 | ttaaaaagaaaaagggatctttattgacg / tgggtttggcttataatcatgct |
| 8 | 293 | 59 | 54-63 | 58, 59, 61 | agaagagacgacagcctctgacc / ggcagccagtgtctaaagcc** |
NOTE: *primer sequence submitted (ctA_tctctcagcggtttaatgtgagt) has mismatches at its 5' end (no match in the human genome). **primer sequence submitted (ggcagccagtgtGtaaagcc) has one mismatch.
Legend:
Exon: exon number. Length (in bp): length of PCR fragment (in base
pair). Tm (in oC): calculated melting temperature DNA
fragment (in oC). DHPLC gradient: DHPLC temperature
gradient. DHPLC temperatures
(in oC): temperatures for DHLC analysis (in oC). Forward
primer / reverse primer:
sequence of PCR forward and reverse primer (5' to 3').
| Top of page | LMDp homepage
| NMD
diagnosis |
| Remarks / information | Copyright©,
liability |